Rroxscaffold_5G00377360

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
57887194 .. 57888965
1772 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00377360.1

Sequence Viewer

Length: 186 bp
ATGGATCTGATCAATTTTATAACTGTAATCTTTTCTTCTGTCATATTGCCATTTCTTCGATTTGGCTGTAAATTTGAAAAAATTGTGTATCTTTTGTTTGTGAGGTCGTATTGTTTGGCTGTTAAAACCCTCTGCCAACCTCATCTCTCAGGTATAGTTTCTGGGTTTGAGTTTTTATTGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.99

Weight (kDa)

8.59

Isoelectric Point (pI)

28.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 20
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 71
AgsI TTSAA 1 cut(s) 77
AlwI GGATC 1 cut(s) 12
ApoI RAATTY 1 cut(s) 71
BclI TGATCA 1 cut(s) 9
BseMII CTCAG 1 cut(s) 162
Bsp143I GATC 2 cut(s) 4, 9
BspCNI CTCAG 1 cut(s) 161
BspPI GGATC 1 cut(s) 12
BssMI GATC 2 cut(s) 4, 9
Bst4CI ACNGT 1 cut(s) 25
BstDEI CTNAG 1 cut(s) 148
BstKTI GATC 2 cut(s) 7, 12
BstMBI GATC 2 cut(s) 4, 9
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
CviJI RGCY 2 cut(s) 66, 119
CviKI_1 RGCY 2 cut(s) 66, 119
DdeI CTNAG 1 cut(s) 148
DpnI GATC 2 cut(s) 6, 11
DpnII GATC 2 cut(s) 4, 9
FaiI YATR 3 cut(s) 20, 44, 155
FbaI TGATCA 1 cut(s) 9
Hpy188I TCNGA 1 cut(s) 9
HpyCH4III ACNGT 1 cut(s) 25
HpyF3I CTNAG 1 cut(s) 148
Ksp22I TGATCA 1 cut(s) 9
Kzo9I GATC 2 cut(s) 4, 9
LpnPI CCDG 2 cut(s) 135, 147
MalI GATC 2 cut(s) 6, 11
MboI GATC 2 cut(s) 4, 9
MboII GAAGA 2 cut(s) 27, 47
MflI RGATCY 1 cut(s) 4
MluCI AATT 3 cut(s) 13, 71, 81
MnlI CCTC 3 cut(s) 96, 140, 150
MseI TTAA 1 cut(s) 123
NdeII GATC 2 cut(s) 4, 9
PsiI TTATAA 1 cut(s) 20
PsuI RGATCY 1 cut(s) 4
SaqAI TTAA 1 cut(s) 123
Sau3AI GATC 2 cut(s) 4, 9
SetI ASST 3 cut(s) 107, 142, 154
SgeI CNNG 2 cut(s) 162, 174
Sse9I AATT 3 cut(s) 13, 71, 81
TaaI ACNGT 1 cut(s) 25
TaqI TCGA 1 cut(s) 58
TasI AATT 3 cut(s) 13, 71, 81
Tru1I TTAA 1 cut(s) 123
Tru9I TTAA 1 cut(s) 123
XapI RAATTY 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.