Rh5AG158200

Belongs to the cation transport ATPase (P-type) (TC 3.A.3) family. Type IV subfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
16725800 .. 16726867
1068 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG158200.1

Sequence Viewer

Length: 297 bp
ATGGATCTGATCAATTTTATAACTGTAATCTTTTCTTCTGTCATATTGCGATTTCTTCGATTTGGCTGTAAAATTGTGTATCTTTTGTTTGTGAGGTCGTATTGTTTGGCTGTTAAAACCCTCTGCCAACCTCATCTCTCAGCTCCTGCAGTGGAGGATAAGTCCAAAGTTTCCAGGGCATTGAAGGAAAGTGTTCTCCATCAAATATGTGAGGCAAAGCCATTGGCTCTGATCATTGATTGGAATTCACTCCTGTCTAACAAAAAGAAGAGAACTGTGATGCACATACTATATTAG

Protein Analysis

98

Amino Acids

11.25

Weight (kDa)

9.65

Isoelectric Point (pI)

46.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 20
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 244
AgsI TTSAA 1 cut(s) 184
AjnI CCWGG 1 cut(s) 173
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
AlwI GGATC 1 cut(s) 12
AlwNI CAGNNNCTG 1 cut(s) 146
ApoI RAATTY 1 cut(s) 244
Asp700I GAANNNNTTC 1 cut(s) 192
BccI CCATC 1 cut(s) 207
BciT130I CCWGG 1 cut(s) 175
BclI TGATCA 2 cut(s) 9, 231
BfmI CTRYAG 1 cut(s) 147
Bme1390I CCNGG 1 cut(s) 175
BmrFI CCNGG 1 cut(s) 175
BmsI GCATC 1 cut(s) 270
BsaJI CCNNGG 1 cut(s) 174
BsaXI ACNNNNNCTCC 2 cut(s) 146, 176
BseBI CCWGG 1 cut(s) 175
BseDI CCNNGG 1 cut(s) 174
BseMII CTCAG 1 cut(s) 153
Bsp143I GATC 3 cut(s) 4, 9, 231
BspCNI CTCAG 1 cut(s) 152
BspMAI CTGCAG 1 cut(s) 151
BspPI GGATC 1 cut(s) 12
BssECI CCNNGG 1 cut(s) 174
BssMI GATC 3 cut(s) 4, 9, 231
Bst2UI CCWGG 1 cut(s) 175
Bst4CI ACNGT 2 cut(s) 25, 277
Bst6I CTCTTC 1 cut(s) 263
BstDEI CTNAG 1 cut(s) 139
BstKTI GATC 3 cut(s) 7, 12, 234
BstMBI GATC 3 cut(s) 4, 9, 231
BstNI CCWGG 1 cut(s) 175
BstSCI CCNGG 1 cut(s) 173
BstSFI CTRYAG 1 cut(s) 147
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BtsI GCAGTG 1 cut(s) 156
BtsIMutI CAGTG 1 cut(s) 156
CaiI CAGNNNCTG 1 cut(s) 146
CviJI RGCY 5 cut(s) 66, 110, 143, 220, 227
CviKI_1 RGCY 5 cut(s) 66, 110, 143, 220, 227
DdeI CTNAG 1 cut(s) 139
DpnI GATC 3 cut(s) 6, 11, 233
DpnII GATC 3 cut(s) 4, 9, 231
Eam1104I CTCTTC 1 cut(s) 263
EarI CTCTTC 1 cut(s) 263
EcoRI GAATTC 1 cut(s) 244
EcoRII CCWGG 1 cut(s) 173
FaiI YATR 5 cut(s) 20, 44, 208, 287, 292
FbaI TGATCA 2 cut(s) 9, 231
Hpy188I TCNGA 2 cut(s) 9, 231
HpyAV CCTTC 1 cut(s) 178
HpyCH4III ACNGT 2 cut(s) 25, 277
HpyCH4V TGCA 2 cut(s) 149, 283
HpyF3I CTNAG 1 cut(s) 139
Ksp22I TGATCA 2 cut(s) 9, 231
Kzo9I GATC 3 cut(s) 4, 9, 231
LmnI GCTCC 1 cut(s) 148
LpnPI CCDG 4 cut(s) 159, 160, 187, 266
LweI GCATC 1 cut(s) 270
MalI GATC 3 cut(s) 6, 11, 233
MboI GATC 3 cut(s) 4, 9, 231
MboII GAAGA 3 cut(s) 27, 47, 280
MflI RGATCY 1 cut(s) 4
MluCI AATT 3 cut(s) 13, 72, 244
MnlI CCTC 5 cut(s) 87, 131, 141, 148, 205
MroXI GAANNNNTTC 1 cut(s) 192
MseI TTAA 1 cut(s) 114
MspR9I CCNGG 1 cut(s) 175
MvaI CCWGG 1 cut(s) 175
NdeII GATC 3 cut(s) 4, 9, 231
PdmI GAANNNNTTC 1 cut(s) 192
PsiI TTATAA 1 cut(s) 20
Psp6I CCWGG 1 cut(s) 173
PspGI CCWGG 1 cut(s) 173
PstI CTGCAG 1 cut(s) 151
PstNI CAGNNNCTG 1 cut(s) 146
PsuI RGATCY 1 cut(s) 4
SaqAI TTAA 1 cut(s) 114
Sau3AI GATC 3 cut(s) 4, 9, 231
ScrFI CCNGG 1 cut(s) 175
SetI ASST 3 cut(s) 98, 133, 145
SfaNI GCATC 1 cut(s) 270
SfcI CTRYAG 1 cut(s) 147
SgeI CNNG 4 cut(s) 158, 186, 187, 265
Sse9I AATT 3 cut(s) 13, 72, 244
StyD4I CCNGG 1 cut(s) 173
TaaI ACNGT 2 cut(s) 25, 277
TaqI TCGA 1 cut(s) 58
TasI AATT 3 cut(s) 13, 72, 244
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TscAI CASTG 1 cut(s) 156
TspRI CASTG 1 cut(s) 156
XapI RAATTY 1 cut(s) 244
XmnI GAANNNNTTC 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.