Rh3DG144100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
12303184 .. 12304227
1044 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG144100.1

Sequence Viewer

Length: 321 bp
ATGGATCTGATCAATTTTATAACTGTAATCTTTTCTTCTGTCATATTGCGATTTCTTCGATTTGGCTGTAAAATTGTGTATCTTTTGTTTGTGAGGTCGTATTGTTTGGCTGTTAAAACCCTCTGCCAACCTCATCTCTCATGTATAGTTTCTGGGTTTGAGATGGACTTTGAATTGGGTTTTCTTGAGGAGACCAATCTTGCATTGAAGGAAAGTGTTCTCCATCAAATATGTGAGGCAAAGCCATTGGCTCTGATCATTGATTGGAATTCACTCCTGTCTAACAAAAAGAAGAGAACTGTGATGCACGTACTATACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

12.24

Weight (kDa)

8.32

Isoelectric Point (pI)

35.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 20
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 268
AfaI GTAC 1 cut(s) 312
AgsI TTSAA 2 cut(s) 173, 208
Alw26I GTCTC 1 cut(s) 185
AlwI GGATC 1 cut(s) 12
ApoI RAATTY 1 cut(s) 268
Asp700I GAANNNNTTC 1 cut(s) 216
BccI CCATC 2 cut(s) 157, 231
BclI TGATCA 2 cut(s) 9, 255
BcoDI GTCTC 1 cut(s) 185
BfaI CTAG 1 cut(s) 319
BmsI GCATC 1 cut(s) 294
BpuEI CTTGAG 1 cut(s) 206
BsaAI YACGTR 1 cut(s) 310
BsaI GGTCTC 1 cut(s) 185
BseRI GAGGAG 1 cut(s) 203
BsmAI GTCTC 1 cut(s) 185
Bso31I GGTCTC 1 cut(s) 185
Bsp143I GATC 3 cut(s) 4, 9, 255
BspPI GGATC 1 cut(s) 12
BspTNI GGTCTC 1 cut(s) 185
BssMI GATC 3 cut(s) 4, 9, 255
Bst4CI ACNGT 2 cut(s) 25, 301
Bst6I CTCTTC 1 cut(s) 287
BstBAI YACGTR 1 cut(s) 310
BstKTI GATC 3 cut(s) 7, 12, 258
BstMAI GTCTC 1 cut(s) 185
BstMBI GATC 3 cut(s) 4, 9, 255
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
Csp6I GTAC 1 cut(s) 311
CviAII CATG 1 cut(s) 141
CviJI RGCY 4 cut(s) 66, 110, 244, 251
CviKI_1 RGCY 4 cut(s) 66, 110, 244, 251
CviQI GTAC 1 cut(s) 311
DpnI GATC 3 cut(s) 6, 11, 257
DpnII GATC 3 cut(s) 4, 9, 255
Eam1104I CTCTTC 1 cut(s) 287
EarI CTCTTC 1 cut(s) 287
Eco31I GGTCTC 1 cut(s) 185
EcoRI GAATTC 1 cut(s) 268
FaeI CATG 1 cut(s) 144
FaiI YATR 6 cut(s) 20, 44, 142, 146, 232, 316
FatI CATG 1 cut(s) 140
FbaI TGATCA 2 cut(s) 9, 255
FspBI CTAG 1 cut(s) 319
Hin1II CATG 1 cut(s) 144
Hpy188I TCNGA 2 cut(s) 9, 255
Hpy188III TCNNGA 1 cut(s) 185
HpyAV CCTTC 1 cut(s) 202
HpyCH4III ACNGT 2 cut(s) 25, 301
HpyCH4IV ACGT 1 cut(s) 309
HpyCH4V TGCA 2 cut(s) 203, 307
HpySE526I ACGT 1 cut(s) 309
Hsp92II CATG 1 cut(s) 144
Ksp22I TGATCA 2 cut(s) 9, 255
Kzo9I GATC 3 cut(s) 4, 9, 255
LpnPI CCDG 2 cut(s) 138, 290
LweI GCATC 1 cut(s) 294
MaeI CTAG 1 cut(s) 319
MaeII ACGT 1 cut(s) 309
MalI GATC 3 cut(s) 6, 11, 257
MboI GATC 3 cut(s) 4, 9, 255
MboII GAAGA 3 cut(s) 27, 47, 304
MflI RGATCY 1 cut(s) 4
MluCI AATT 4 cut(s) 13, 72, 173, 268
MnlI CCTC 5 cut(s) 87, 131, 141, 181, 229
MroXI GAANNNNTTC 1 cut(s) 216
MseI TTAA 1 cut(s) 114
NdeII GATC 3 cut(s) 4, 9, 255
NlaIII CATG 1 cut(s) 144
PdmI GAANNNNTTC 1 cut(s) 216
Ppu21I YACGTR 1 cut(s) 310
PsiI TTATAA 1 cut(s) 20
PsuI RGATCY 1 cut(s) 4
RsaI GTAC 1 cut(s) 312
RsaNI GTAC 1 cut(s) 311
SaqAI TTAA 1 cut(s) 114
Sau3AI GATC 3 cut(s) 4, 9, 255
SetI ASST 3 cut(s) 98, 133, 312
SfaNI GCATC 1 cut(s) 294
SgeI CNNG 5 cut(s) 153, 165, 197, 212, 289
SmlI CTYRAG 1 cut(s) 185
SmoI CTYRAG 1 cut(s) 185
Sse9I AATT 4 cut(s) 13, 72, 173, 268
SspMI CTAG 1 cut(s) 319
TaaI ACNGT 2 cut(s) 25, 301
TaiI ACGT 1 cut(s) 312
TaqI TCGA 1 cut(s) 58
TasI AATT 4 cut(s) 13, 72, 173, 268
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
XapI RAATTY 1 cut(s) 268
XmnI GAANNNNTTC 1 cut(s) 216
XspI CTAG 1 cut(s) 319
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.