Rroxscaffold_6G00418330

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
39854827 .. 39858387
3561 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00418330.1

Sequence Viewer

Length: 153 bp
ATGGGAGGCTTGGGAATGAGTTATGTCTACAACGTTGGCTCGAAACCGCCATATGAACGGAAATTAGATGATCCGATTGAGTACCCGTCACACTCCGTAGATAAATTAGCTAGTTTTTGTTTAGTGATCAAAGATATGGTTTGGGGAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.61

Weight (kDa)

5.04

Isoelectric Point (pI)

25.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019395)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0461391
rosa_roxburghii Rroxscaffold_6G00418330 Rroxscaffold_6G00418620
rosa_rugosa Rorug03G0050200
rosa_samantha Rh3AG108100 Rh3BG112200 Rh3DG113800
rosa_wichuraiana Rw3G009220

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 27
AciI CCGC 1 cut(s) 47
AclI AACGTT 1 cut(s) 33
AclWI GGATC 1 cut(s) 65
AfaI GTAC 1 cut(s) 83
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
AlwI GGATC 1 cut(s) 65
BclI TGATCA 1 cut(s) 126
BfaI CTAG 1 cut(s) 111
Bsp143I GATC 2 cut(s) 70, 126
BspACI CCGC 1 cut(s) 47
BspPI GGATC 1 cut(s) 65
BssMI GATC 2 cut(s) 70, 126
BstKTI GATC 2 cut(s) 73, 129
BstMBI GATC 2 cut(s) 70, 126
Csp6I GTAC 1 cut(s) 82
CviJI RGCY 3 cut(s) 9, 39, 110
CviKI_1 RGCY 3 cut(s) 9, 39, 110
CviQI GTAC 1 cut(s) 82
DpnI GATC 2 cut(s) 72, 128
DpnII GATC 2 cut(s) 70, 126
FaiI YATR 4 cut(s) 24, 52, 54, 137
FauNDI CATATG 1 cut(s) 52
FbaI TGATCA 1 cut(s) 126
FblI GTMKAC 1 cut(s) 27
FspBI CTAG 1 cut(s) 111
Hpy166II GTNNAC 1 cut(s) 28
Hpy188I TCNGA 1 cut(s) 75
Hpy8I GTNNAC 1 cut(s) 28
HpyCH4IV ACGT 1 cut(s) 33
HpySE526I ACGT 1 cut(s) 33
Ksp22I TGATCA 1 cut(s) 126
Kzo9I GATC 2 cut(s) 70, 126
MaeI CTAG 1 cut(s) 111
MaeII ACGT 1 cut(s) 33
MaeIII GTNAC 1 cut(s) 87
MalI GATC 2 cut(s) 72, 128
MboI GATC 2 cut(s) 70, 126
MluCI AATT 2 cut(s) 62, 104
MseI TTAA 1 cut(s) 151
NdeI CATATG 1 cut(s) 52
NdeII GATC 2 cut(s) 70, 126
NmuCI GTSAC 1 cut(s) 87
Psp1406I AACGTT 1 cut(s) 33
RsaI GTAC 1 cut(s) 83
RsaNI GTAC 1 cut(s) 82
SaqAI TTAA 1 cut(s) 151
Sau3AI GATC 2 cut(s) 70, 126
SetI ASST 2 cut(s) 36, 112
SgeI CNNG 4 cut(s) 22, 52, 97, 123
Sse9I AATT 2 cut(s) 62, 104
SsiI CCGC 1 cut(s) 47
SspMI CTAG 1 cut(s) 111
TaiI ACGT 1 cut(s) 36
TaqI TCGA 1 cut(s) 41
TasI AATT 2 cut(s) 62, 104
Tru1I TTAA 1 cut(s) 151
Tru9I TTAA 1 cut(s) 151
TseFI GTSAC 1 cut(s) 87
Tsp45I GTSAC 1 cut(s) 87
TspDTI ATGAA 1 cut(s) 69
TspGWI ACGGA 2 cut(s) 73, 85
XmiI GTMKAC 1 cut(s) 27
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.