Rorug02G0164900

transcription regulatory region sequence-specific DNA binding

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
14713892 .. 14714146
255 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0164900.1

Sequence Viewer

Length: 255 bp
ATGTCATTGCTGAGACCTTCCCCAACATTTAATGAAGATATAAAACTCACCGACGAGAAATACGGATTGGTTCCAAGAGTGTTCATCGTGTGCGACCAAGACCTTACAATAGAGGAGGAAATACAAATGTGGATGATCAGGGAGAACCCACCAAATGAAGTAAAAGTGATAAATGGTTCCGATCACATGGTCATGTTCTCTAGACCACTGGAGCTGTTCTCCAACCTCCTCAAGATTGCTGAGAAATATTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.84

Weight (kDa)

4.72

Isoelectric Point (pI)

52.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016722)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjuI GAANNNNNNNTTGG 2 cut(s) 50, 82
AluBI AGCT 1 cut(s) 214
AluI AGCT 1 cut(s) 214
Alw26I GTCTC 1 cut(s) 7
AsuHPI GGTGA 1 cut(s) 40
BclI TGATCA 1 cut(s) 135
BcoDI GTCTC 1 cut(s) 7
BfaI CTAG 1 cut(s) 201
BmiI GGNNCC 2 cut(s) 72, 178
BplI GAGNNNNNCTC 2 cut(s) 203, 235
BpmI CTGGAG 1 cut(s) 230
BpuEI CTTGAG 1 cut(s) 215
BsaI GGTCTC 1 cut(s) 7
Bse1I ACTGG 1 cut(s) 213
Bse3DI GCAATG 1 cut(s) 5
BseGI GGATG 1 cut(s) 138
BseMI GCAATG 1 cut(s) 5
BseMII CTCAG 1 cut(s) 231
BseNI ACTGG 1 cut(s) 213
BseRI GAGGAG 2 cut(s) 128, 218
BsmAI GTCTC 1 cut(s) 7
Bso31I GGTCTC 1 cut(s) 7
Bsp143I GATC 2 cut(s) 135, 181
BspCNI CTCAG 1 cut(s) 232
BspLI GGNNCC 2 cut(s) 72, 178
BspTNI GGTCTC 1 cut(s) 7
BsrDI GCAATG 1 cut(s) 5
BsrI ACTGG 1 cut(s) 213
BssMI GATC 2 cut(s) 135, 181
BstDEI CTNAG 2 cut(s) 11, 240
BstF5I GGATG 1 cut(s) 138
BstKTI GATC 2 cut(s) 138, 184
BstMAI GTCTC 1 cut(s) 7
BstMBI GATC 2 cut(s) 135, 181
BtsCI GGATG 1 cut(s) 138
BtsIMutI CAGTG 1 cut(s) 206
CviAII CATG 2 cut(s) 187, 193
CviJI RGCY 1 cut(s) 214
CviKI_1 RGCY 1 cut(s) 214
DdeI CTNAG 2 cut(s) 11, 240
DpnI GATC 2 cut(s) 137, 183
DpnII GATC 2 cut(s) 135, 181
Eco31I GGTCTC 1 cut(s) 7
FaeI CATG 2 cut(s) 190, 196
FaiI YATR 4 cut(s) 41, 188, 194, 253
FatI CATG 2 cut(s) 186, 192
FbaI TGATCA 1 cut(s) 135
FokI GGATG 1 cut(s) 145
FspBI CTAG 1 cut(s) 201
GsuI CTGGAG 1 cut(s) 230
Hin1II CATG 2 cut(s) 190, 196
HphI GGTGA 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 181
Hpy188III TCNNGA 2 cut(s) 201, 232
Hpy99I CGWCG 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 27
HpyF3I CTNAG 2 cut(s) 11, 240
Hsp92II CATG 2 cut(s) 190, 196
Ksp22I TGATCA 1 cut(s) 135
Kzo9I GATC 2 cut(s) 135, 181
LmnI GCTCC 1 cut(s) 211
LpnPI CCDG 2 cut(s) 124, 194
MaeI CTAG 1 cut(s) 201
MalI GATC 2 cut(s) 137, 183
MboI GATC 2 cut(s) 135, 181
MboII GAAGA 1 cut(s) 47
MmeI TCCRAC 1 cut(s) 246
MnlI CCTC 4 cut(s) 106, 109, 236, 239
MseI TTAA 1 cut(s) 30
MslI CAYNNNNRTG 1 cut(s) 191
NdeII GATC 2 cut(s) 135, 181
NlaIII CATG 2 cut(s) 190, 196
NlaIV GGNNCC 2 cut(s) 72, 178
PspN4I GGNNCC 2 cut(s) 72, 178
RseI CAYNNNNRTG 1 cut(s) 191
SaqAI TTAA 1 cut(s) 30
Sau3AI GATC 2 cut(s) 135, 181
SetI ASST 4 cut(s) 19, 105, 216, 228
SmiMI CAYNNNNRTG 1 cut(s) 191
SmlI CTYRAG 1 cut(s) 230
SmoI CTYRAG 1 cut(s) 230
SspI AATATT 1 cut(s) 248
SspMI CTAG 1 cut(s) 201
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TscAI CASTG 1 cut(s) 213
TspDTI ATGAA 4 cut(s) 48, 73, 171, 240
TspGWI ACGGA 1 cut(s) 78
TspRI CASTG 1 cut(s) 213
XbaI TCTAGA 1 cut(s) 200
XspI CTAG 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.