Rorug02G0402800

DEAD-box ATP-dependent RNA helicase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
51476430 .. 51476657
228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0402800.1

Sequence Viewer

Length: 228 bp
ATGAGGATATACGAGGTGGTGATGAAGGAGATAACGGTGTACACAGGGCTATCACTGACGGCGTTTTTCGCAATCGCTAGGTTGATGGTCGTCGTTTACAGATATGTTATCGGAATGTTTATGGCTCTCGAAGATTACAACAATCCTCCGGTGGTGAGTAGTGCTAATTCGGAATTTTTGAACAAGTATTTCAATCCCAAGATCGCCACGACGCCAAGCTCAATCTAA

Protein Analysis

75

Amino Acids

8.54

Weight (kDa)

8.01

Isoelectric Point (pI)

23.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013476)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 173
AcyI GRCGYC 1 cut(s) 212
AfaI GTAC 1 cut(s) 41
AgsI TTSAA 2 cut(s) 181, 193
AluBI AGCT 1 cut(s) 219
AluI AGCT 1 cut(s) 219
ApoI RAATTY 1 cut(s) 173
AsuHPI GGTGA 2 cut(s) 31, 166
BccI CCATC 1 cut(s) 79
BceAI ACGGC 1 cut(s) 75
BfaI CTAG 1 cut(s) 78
BsaHI GRCGYC 1 cut(s) 212
BsaWI WCCGGW 1 cut(s) 148
BsiSI CCGG 1 cut(s) 149
Bsp1407I TGTACA 1 cut(s) 39
Bsp143I GATC 1 cut(s) 201
BsrGI TGTACA 1 cut(s) 39
BssMI GATC 1 cut(s) 201
BssNI GRCGYC 1 cut(s) 212
Bst4CI ACNGT 1 cut(s) 37
BstACI GRCGYC 1 cut(s) 212
BstAUI TGTACA 1 cut(s) 39
BstKTI GATC 1 cut(s) 204
BstMBI GATC 1 cut(s) 201
BstMWI GCNNNNNNNGC 1 cut(s) 68
BtsIMutI CAGTG 1 cut(s) 53
CseI GACGC 1 cut(s) 220
Csp6I GTAC 1 cut(s) 40
CviJI RGCY 3 cut(s) 49, 125, 219
CviKI_1 RGCY 3 cut(s) 49, 125, 219
CviQI GTAC 1 cut(s) 40
DpnI GATC 1 cut(s) 203
DpnII GATC 1 cut(s) 201
FaiI YATR 3 cut(s) 10, 105, 122
FspBI CTAG 1 cut(s) 78
HapII CCGG 1 cut(s) 149
HgaI GACGC 1 cut(s) 220
Hin1I GRCGYC 1 cut(s) 212
HpaII CCGG 1 cut(s) 149
HphI GGTGA 2 cut(s) 31, 166
Hpy166II GTNNAC 3 cut(s) 40, 42, 97
Hpy188I TCNGA 2 cut(s) 113, 172
Hpy188III TCNNGA 1 cut(s) 128
Hpy8I GTNNAC 3 cut(s) 40, 42, 97
Hpy99I CGWCG 2 cut(s) 95, 214
HpyAV CCTTC 1 cut(s) 19
HpyCH4III ACNGT 1 cut(s) 37
HpyF10VI GCNNNNNNNGC 1 cut(s) 68
Hsp92I GRCGYC 1 cut(s) 212
Kzo9I GATC 1 cut(s) 201
LpnPI CCDG 2 cut(s) 30, 162
MaeI CTAG 1 cut(s) 78
MalI GATC 1 cut(s) 203
MboI GATC 1 cut(s) 201
MboII GAAGA 1 cut(s) 143
MluCI AATT 2 cut(s) 166, 173
MnlI CCTC 2 cut(s) 7, 156
MspI CCGG 1 cut(s) 149
MwoI GCNNNNNNNGC 1 cut(s) 68
NdeII GATC 1 cut(s) 201
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
Sau3AI GATC 1 cut(s) 201
SetI ASST 3 cut(s) 18, 83, 221
SgeI CNNG 8 cut(s) 25, 57, 90, 140, 161, 196, 211, 220
Sse9I AATT 2 cut(s) 166, 173
SspMI CTAG 1 cut(s) 78
TaaI ACNGT 1 cut(s) 37
TaqI TCGA 1 cut(s) 129
TasI AATT 2 cut(s) 166, 173
TatI WGTACW 1 cut(s) 39
TscAI CASTG 1 cut(s) 60
TspDTI ATGAA 1 cut(s) 38
TspRI CASTG 1 cut(s) 60
XapI RAATTY 1 cut(s) 173
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.