Rorug02G0451800

protein FAR1-RELATED SEQUENCE

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0007860
Physical Location & Seq
Reverse (-)
57941760 .. 57942316
557 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0451800.1

Sequence Viewer

Length: 255 bp
ATGAAGGCATGGTCTAGAATTCTTGCTGCTCTAGTACTTGCATTTTCGATGGTATTATCAACCTGGCCGAATGGAGCAACAGCGCAGGCTCATCCGCTAAAATCTGCCCCAACAAACCGAGCTTCATCATCTTCAGAATCCCTCAAAGATTTGCAGGCAAACAGTAAGAGCCCTTTTAAGCTGGCTGGCTCAAGCTTCCGAAAGATCCCGCCTAGTACTTCGAATCCCACGCAGAACAAGTACAGTCCTCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAR1 MULE SWIM

Protein Analysis

84

Amino Acids

8.96

Weight (kDa)

10.77

Isoelectric Point (pI)

41.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 95, 209
AclWI GGATC 1 cut(s) 199
AcoI YGGCCR 1 cut(s) 65
AcsI RAATTY 1 cut(s) 18
AcuI CTGAAG 1 cut(s) 117
AfaI GTAC 3 cut(s) 36, 217, 242
AjnI CCWGG 1 cut(s) 62
AluBI AGCT 3 cut(s) 122, 181, 195
AluI AGCT 3 cut(s) 122, 181, 195
AlwI GGATC 1 cut(s) 199
AoxI GGCC 1 cut(s) 65
ApeKI GCWGC 1 cut(s) 26
ApoI RAATTY 1 cut(s) 18
AspLEI GCGC 1 cut(s) 85
AsuII TTCGAA 1 cut(s) 221
BanII GRGCYC 1 cut(s) 173
BbvI GCAGC 1 cut(s) 13
BccI CCATC 1 cut(s) 43
BciT130I CCWGG 1 cut(s) 64
BfaI CTAG 3 cut(s) 15, 32, 213
BisI GCNGC 1 cut(s) 27
BlsI GCNGC 1 cut(s) 28
BmcAI AGTACT 2 cut(s) 36, 217
Bme1390I CCNGG 1 cut(s) 64
BmrFI CCNGG 1 cut(s) 64
Bpu14I TTCGAA 1 cut(s) 221
BpuEI CTTGAG 1 cut(s) 175
BseBI CCWGG 1 cut(s) 64
BseGI GGATG 1 cut(s) 91
BseXI GCAGC 1 cut(s) 13
BshFI GGCC 1 cut(s) 67
BsnI GGCC 1 cut(s) 67
Bsp119I TTCGAA 1 cut(s) 221
Bsp1286I GDGCHC 1 cut(s) 173
Bsp143I GATC 1 cut(s) 204
BspACI CCGC 2 cut(s) 95, 209
BspANI GGCC 1 cut(s) 67
BspPI GGATC 1 cut(s) 199
BspT104I TTCGAA 1 cut(s) 221
BssMI GATC 1 cut(s) 204
Bst2UI CCWGG 1 cut(s) 64
Bst4CI ACNGT 2 cut(s) 164, 245
BstBI TTCGAA 1 cut(s) 221
BstC8I GCNNGC 4 cut(s) 87, 156, 183, 187
BstF5I GGATG 1 cut(s) 91
BstHHI GCGC 1 cut(s) 85
BstKTI GATC 1 cut(s) 207
BstMBI GATC 1 cut(s) 204
BstNI CCWGG 1 cut(s) 64
BstSCI CCNGG 1 cut(s) 62
BstV1I GCAGC 1 cut(s) 13
BstX2I RGATCY 1 cut(s) 204
BstYI RGATCY 1 cut(s) 204
BsuRI GGCC 1 cut(s) 67
BtsCI GGATG 1 cut(s) 91
Cac8I GCNNGC 4 cut(s) 87, 156, 183, 187
CfoI GCGC 1 cut(s) 85
Csp6I GTAC 3 cut(s) 35, 216, 241
CviAII CATG 1 cut(s) 9
CviJI RGCY 8 cut(s) 67, 89, 122, 171, 181, 185, 189, 195
CviKI_1 RGCY 8 cut(s) 67, 89, 122, 171, 181, 185, 189, 195
CviQI GTAC 3 cut(s) 35, 216, 241
DpnI GATC 1 cut(s) 206
DpnII GATC 1 cut(s) 204
EaeI YGGCCR 1 cut(s) 65
Eco24I GRGCYC 1 cut(s) 173
Eco57I CTGAAG 1 cut(s) 117
EcoRI GAATTC 1 cut(s) 18
EcoRII CCWGG 1 cut(s) 62
EcoT38I GRGCYC 1 cut(s) 173
FaeI CATG 1 cut(s) 12
FaiI YATR 2 cut(s) 10, 253
FatI CATG 1 cut(s) 8
FauI CCCGC 1 cut(s) 216
Fnu4HI GCNGC 1 cut(s) 27
FokI GGATG 1 cut(s) 78
FriOI GRGCYC 1 cut(s) 173
Fsp4HI GCNGC 1 cut(s) 27
FspBI CTAG 3 cut(s) 15, 32, 213
GlaI GCGC 1 cut(s) 84
GluI GCNGC 1 cut(s) 27
HaeIII GGCC 1 cut(s) 67
HhaI GCGC 1 cut(s) 85
Hin1II CATG 1 cut(s) 12
Hin6I GCGC 1 cut(s) 83
HinP1I GCGC 1 cut(s) 83
HindIII AAGCTT 1 cut(s) 193
HinfI GANTC 2 cut(s) 137, 223
Hpy188I TCNGA 2 cut(s) 136, 200
Hpy188III TCNNGA 1 cut(s) 15
HpyCH4III ACNGT 2 cut(s) 164, 245
HpyCH4V TGCA 2 cut(s) 41, 154
Hsp92II CATG 1 cut(s) 12
HspAI GCGC 1 cut(s) 83
Kzo9I GATC 1 cut(s) 204
LmnI GCTCC 1 cut(s) 74
LpnPI CCDG 6 cut(s) 49, 71, 76, 140, 167, 171
Lsp1109I GCAGC 1 cut(s) 13
MaeI CTAG 3 cut(s) 15, 32, 213
MalI GATC 1 cut(s) 206
MboI GATC 1 cut(s) 204
MboII GAAGA 1 cut(s) 123
MflI RGATCY 1 cut(s) 204
MhlI GDGCHC 1 cut(s) 173
MluCI AATT 1 cut(s) 18
MnlI CCTC 1 cut(s) 152
MseI TTAA 1 cut(s) 177
MspR9I CCNGG 1 cut(s) 64
MvaI CCWGG 1 cut(s) 64
NdeII GATC 1 cut(s) 204
NlaIII CATG 1 cut(s) 12
NspV TTCGAA 1 cut(s) 221
PfeI GAWTC 2 cut(s) 137, 223
PkrI GCNGC 1 cut(s) 28
Psp6I CCWGG 1 cut(s) 62
PspGI CCWGG 1 cut(s) 62
PsuI RGATCY 1 cut(s) 204
RsaI GTAC 3 cut(s) 36, 217, 242
RsaNI GTAC 3 cut(s) 35, 216, 241
SaqAI TTAA 1 cut(s) 177
SatI GCNGC 1 cut(s) 27
Sau3AI GATC 1 cut(s) 204
ScaI AGTACT 2 cut(s) 36, 217
ScrFI CCNGG 1 cut(s) 64
SduI GDGCHC 1 cut(s) 173
SetI ASST 4 cut(s) 65, 124, 183, 197
SfuI TTCGAA 1 cut(s) 221
SmlI CTYRAG 1 cut(s) 190
SmoI CTYRAG 1 cut(s) 190
Sse9I AATT 1 cut(s) 18
SsiI CCGC 2 cut(s) 95, 209
SspMI CTAG 3 cut(s) 15, 32, 213
StyD4I CCNGG 1 cut(s) 62
TaaI ACNGT 2 cut(s) 164, 245
TaqI TCGA 2 cut(s) 47, 221
TasI AATT 1 cut(s) 18
TatI WGTACW 3 cut(s) 34, 215, 240
TfiI GAWTC 2 cut(s) 137, 223
Tru1I TTAA 1 cut(s) 177
Tru9I TTAA 1 cut(s) 177
TseI GCWGC 1 cut(s) 26
TspDTI ATGAA 2 cut(s) 17, 114
XapI RAATTY 1 cut(s) 18
XbaI TCTAGA 1 cut(s) 14
XspI CTAG 3 cut(s) 15, 32, 213
ZrmI AGTACT 2 cut(s) 36, 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.