Rorug02G0590000

Regulation of nuclear pre-mRNA domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
71218447 .. 71219763
1317 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0590000.1

Sequence Viewer

Length: 612 bp
ATGTTTATAAAACTATACAAAGGGCCCCAAATTGATCAGGGCCCCAAAGTGCCACCGGAGATCAAAACAGAGGTGATAGCATGGATAAAGAGAAAAGATTCTATTAAGCAAGAAAAGGCAGCTGTTCAATATGATATTAGAGAAGAACTCCGCAATGATTATCTTGGCAATCAAACAAGTCTGTACAATGACGATGACGACAATGATGATGATGATGATGGATTTCAGTATCCACCAGACATGCACCCTGCAGAACGACAAGATTATCGTGCTGCAATAAGACGATCAACCGTAGATCGTGATAAGAACTCTCAGTTTAGTAGAAGTGCAAGATTTCAATTTCCAAAACAATCGAGAGGCGGTAGTAGCAGTCAACAACCGCAACATGTTGATCGATCAAAAACCTATCGGTACTCATTTCCTGAGCCTCCAGTAGCAATGCCATCAAAATATAGTCGATCAAAACAAAGCACAATTAAATCATTACTAAAAGGTGGTAGAGAACTATTGGCAACAATGGTGTCCAAATACCACATATATGATACTGTCCCTTTTAACAAAGCTAATTCTCCACACACTACTACAAAATCGAAAATAGACAACGTTACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

203

Amino Acids

23.44

Weight (kDa)

9.3

Isoelectric Point (pI)

64.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 8
AciI CCGC 3 cut(s) 151, 360, 380
AclI AACGTT 1 cut(s) 603
AfaI GTAC 2 cut(s) 185, 413
AflIII ACRYGT 1 cut(s) 385
AgsI TTSAA 2 cut(s) 128, 338
AluBI AGCT 2 cut(s) 122, 563
AluI AGCT 2 cut(s) 122, 563
AoxI GGCC 2 cut(s) 23, 40
ApaI GGGCCC 2 cut(s) 27, 44
ApeKI GCWGC 2 cut(s) 119, 272
Asp700I GAANNNNTTC 1 cut(s) 97
AspS9I GGNCC 4 cut(s) 23, 24, 40, 41
AsuHPI GGTGA 1 cut(s) 85
BaeGI GKGCMC 2 cut(s) 27, 44
BanII GRGCYC 2 cut(s) 27, 44
BbvI GCAGC 2 cut(s) 131, 259
BccI CCATC 2 cut(s) 212, 451
BciVI GTATCC 1 cut(s) 240
BclI TGATCA 1 cut(s) 34
BfaI CTAG 1 cut(s) 610
BfmI CTRYAG 1 cut(s) 249
BfuI GTATCC 1 cut(s) 240
BisI GCNGC 2 cut(s) 120, 273
BlsI GCNGC 2 cut(s) 121, 274
BmgT120I GGNCC 4 cut(s) 23, 24, 40, 41
BmiI GGNNCC 4 cut(s) 25, 26, 42, 43
BplI GAGNNNNNCTC 2 cut(s) 132, 164
BpmI CTGGAG 1 cut(s) 414
Bpu10I CCTNAGC 1 cut(s) 423
Bsa29I ATCGAT 1 cut(s) 394
BsaWI WCCGGW 1 cut(s) 55
Bse1I ACTGG 1 cut(s) 431
Bse3DI GCAATG 2 cut(s) 160, 444
BseCI ATCGAT 1 cut(s) 394
BseMI GCAATG 2 cut(s) 160, 444
BseMII CTCAG 2 cut(s) 326, 414
BseNI ACTGG 1 cut(s) 431
BseSI GKGCMC 2 cut(s) 27, 44
BseXI GCAGC 2 cut(s) 131, 259
BshFI GGCC 2 cut(s) 25, 42
BshVI ATCGAT 1 cut(s) 394
BsiSI CCGG 1 cut(s) 56
BslFI GGGAC 1 cut(s) 533
BsmFI GGGAC 1 cut(s) 533
BsnI GGCC 2 cut(s) 25, 42
Bsp120I GGGCCC 2 cut(s) 23, 40
Bsp1286I GDGCHC 2 cut(s) 27, 44
Bsp1407I TGTACA 1 cut(s) 183
Bsp143I GATC 7 cut(s) 34, 60, 284, 295, 391, 395, 458
BspACI CCGC 3 cut(s) 151, 360, 380
BspANI GGCC 2 cut(s) 25, 42
BspCNI CTCAG 2 cut(s) 325, 415
BspDI ATCGAT 1 cut(s) 394
BspLI GGNNCC 4 cut(s) 25, 26, 42, 43
BspMAI CTGCAG 1 cut(s) 253
BsrDI GCAATG 2 cut(s) 160, 444
BsrGI TGTACA 1 cut(s) 183
BsrI ACTGG 1 cut(s) 431
BssMI GATC 7 cut(s) 34, 60, 284, 295, 391, 395, 458
Bst4CI ACNGT 2 cut(s) 292, 547
BstAUI TGTACA 1 cut(s) 183
BstDEI CTNAG 2 cut(s) 312, 423
BstKTI GATC 7 cut(s) 37, 63, 287, 298, 394, 398, 461
BstMBI GATC 7 cut(s) 34, 60, 284, 295, 391, 395, 458
BstMWI GCNNNNNNNGC 1 cut(s) 366
BstNSI RCATGY 2 cut(s) 244, 389
BstSFI CTRYAG 1 cut(s) 249
BstSLI GKGCMC 2 cut(s) 27, 44
BstV1I GCAGC 2 cut(s) 131, 259
Bsu15I ATCGAT 1 cut(s) 394
BsuI GTATCC 1 cut(s) 240
BsuRI GGCC 2 cut(s) 25, 42
BsuTUI ATCGAT 1 cut(s) 394
Cfr13I GGNCC 4 cut(s) 23, 24, 40, 41
ClaI ATCGAT 1 cut(s) 394
Csp6I GTAC 2 cut(s) 184, 412
CviAII CATG 3 cut(s) 81, 241, 386
CviJI RGCY 5 cut(s) 25, 42, 122, 427, 563
CviKI_1 RGCY 5 cut(s) 25, 42, 122, 427, 563
CviQI GTAC 2 cut(s) 184, 412
DdeI CTNAG 2 cut(s) 312, 423
DpnI GATC 7 cut(s) 36, 62, 286, 297, 393, 397, 460
DpnII GATC 7 cut(s) 34, 60, 284, 295, 391, 395, 458
Eco24I GRGCYC 2 cut(s) 27, 44
EcoO109I RGGNCCY 4 cut(s) 23, 24, 40, 41
EcoT38I GRGCYC 2 cut(s) 27, 44
FaeI CATG 3 cut(s) 84, 244, 389
FaqI GGGAC 1 cut(s) 533
FatI CATG 3 cut(s) 80, 240, 385
FbaI TGATCA 1 cut(s) 34
Fnu4HI GCNGC 2 cut(s) 120, 273
FriOI GRGCYC 2 cut(s) 27, 44
Fsp4HI GCNGC 2 cut(s) 120, 273
FspBI CTAG 1 cut(s) 610
GluI GCNGC 2 cut(s) 120, 273
GsuI CTGGAG 1 cut(s) 414
HaeIII GGCC 2 cut(s) 25, 42
HapII CCGG 1 cut(s) 56
Hin1II CATG 3 cut(s) 84, 244, 389
HincII GTYRAC 1 cut(s) 374
HindII GTYRAC 1 cut(s) 374
HinfI GANTC 1 cut(s) 98
HpaII CCGG 1 cut(s) 56
HphI GGTGA 1 cut(s) 85
Hpy166II GTNNAC 1 cut(s) 374
Hpy188III TCNNGA 3 cut(s) 299, 354, 422
Hpy8I GTNNAC 1 cut(s) 374
HpyCH4III ACNGT 2 cut(s) 292, 547
HpyCH4IV ACGT 1 cut(s) 603
HpyCH4V TGCA 4 cut(s) 244, 251, 275, 329
HpyF10VI GCNNNNNNNGC 1 cut(s) 366
HpyF3I CTNAG 2 cut(s) 312, 423
HpySE526I ACGT 1 cut(s) 603
Hsp92II CATG 3 cut(s) 84, 244, 389
Ksp22I TGATCA 1 cut(s) 34
Kzo9I GATC 7 cut(s) 34, 60, 284, 295, 391, 395, 458
LpnPI CCDG 6 cut(s) 23, 69, 249, 261, 435, 444
Lsp1109I GCAGC 2 cut(s) 131, 259
MaeI CTAG 1 cut(s) 610
MaeII ACGT 1 cut(s) 603
MaeIII GTNAC 1 cut(s) 604
MalI GATC 7 cut(s) 36, 62, 286, 297, 393, 397, 460
MboI GATC 7 cut(s) 34, 60, 284, 295, 391, 395, 458
MboII GAAGA 1 cut(s) 155
MhlI GDGCHC 2 cut(s) 27, 44
MluCI AATT 4 cut(s) 30, 338, 474, 565
MnlI CCTC 3 cut(s) 64, 350, 438
MroXI GAANNNNTTC 1 cut(s) 97
MseI TTAA 3 cut(s) 105, 477, 555
MslI CAYNNNNRTG 1 cut(s) 537
MspA1I CMGCKG 1 cut(s) 122
MspI CCGG 1 cut(s) 56
MwoI GCNNNNNNNGC 1 cut(s) 366
NdeII GATC 7 cut(s) 34, 60, 284, 295, 391, 395, 458
NlaIII CATG 3 cut(s) 84, 244, 389
NlaIV GGNNCC 4 cut(s) 25, 26, 42, 43
NspI RCATGY 2 cut(s) 244, 389
PciI ACATGT 1 cut(s) 385
PdmI GAANNNNTTC 1 cut(s) 97
PfeI GAWTC 1 cut(s) 98
PkrI GCNGC 2 cut(s) 121, 274
PscI ACATGT 1 cut(s) 385
PsiI TTATAA 1 cut(s) 8
Psp1406I AACGTT 1 cut(s) 603
PspN4I GGNNCC 4 cut(s) 25, 26, 42, 43
PspOMI GGGCCC 2 cut(s) 23, 40
PspPI GGNCC 4 cut(s) 23, 24, 40, 41
PstI CTGCAG 1 cut(s) 253
PvuII CAGCTG 1 cut(s) 122
RsaI GTAC 2 cut(s) 185, 413
RsaNI GTAC 2 cut(s) 184, 412
RseI CAYNNNNRTG 1 cut(s) 537
SaqAI TTAA 3 cut(s) 105, 477, 555
SatI GCNGC 2 cut(s) 120, 273
Sau3AI GATC 7 cut(s) 34, 60, 284, 295, 391, 395, 458
Sau96I GGNCC 4 cut(s) 23, 24, 40, 41
SduI GDGCHC 2 cut(s) 27, 44
SetI ASST 7 cut(s) 75, 124, 407, 496, 565, 606, 611
SfcI CTRYAG 1 cut(s) 249
SmiMI CAYNNNNRTG 1 cut(s) 537
Sse9I AATT 4 cut(s) 30, 338, 474, 565
SsiI CCGC 3 cut(s) 151, 360, 380
SspMI CTAG 1 cut(s) 610
TaaI ACNGT 2 cut(s) 292, 547
TaiI ACGT 1 cut(s) 606
TaqI TCGA 4 cut(s) 353, 394, 457, 590
TasI AATT 4 cut(s) 30, 338, 474, 565
TatI WGTACW 1 cut(s) 183
TfiI GAWTC 1 cut(s) 98
Tru1I TTAA 3 cut(s) 105, 477, 555
Tru9I TTAA 3 cut(s) 105, 477, 555
TseI GCWGC 2 cut(s) 119, 272
XceI RCATGY 2 cut(s) 244, 389
XmnI GAANNNNTTC 1 cut(s) 97
XspI CTAG 1 cut(s) 610
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.