Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000003

Orthogroup ID

OG0018456

Physical Location & Seq

Genomic Coordinates Reverse (-)

4277872 .. 4278657

Gene Structure 786 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug03G0055800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 366 bp

ATGAAAAAAGGCAGCAGCATAATTTGCTCAACATCAGTTAATGCATACAAGGGAAACCAGAAGCTGCTTGATTATACAGCAACCAAGGGAGCCATTGTGGCATTTGTAAGAGGATTGTCACCTGAGCTAGTGAACAAAGGCATCCGTGTCAATGGTGTAGCTCCTGGACCAATATGGACCCCATTGATTCCAGCATCTTTCGATGAGGAGGAAACTGCAAACTTTGGCTCTGAAGTGCCAATGCAGCGAGCTGGGCAGCCCTGTGAGGTTGCGCCATCCTATGTCTTCCTTGCTTCCAATGCTTTCTCTTCTTATATAAGCGGCCAAGTGATCCATCCTAATGGGGGGGTTGTAGTAAATTCGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04110 ko04111 ko04114 ko04120 ko04141 ko04310 ko04341 ko04350 ko04710 ko05168 ko05200 map04110 map04111 map04114 map04120 map04141 map04310 map04341 map04350 map04710 map05168 map05200

Pfam Domains

Protein Families

Skp1 Skp1_POZ

Protein Analysis

121

Amino Acids

12.72

Weight (kDa)

7.76

Isoelectric Point (pI)

23.44

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
adh_short_C2	PF13561	1 - 117	1.6e-26	Enoyl-(Acyl carrier protein) reductase
adh_short	PF00106	3 - 67	7.2e-12	short chain dehydrogenase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018456)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g11010
rosa_chinensis	RchiOBHm_Chr3g0462321
rosa_laevigata	RLG00000024867
rosa_multiflora	Rmu_sc0009800.1_g000001
rosa_roxburghii	Rroxscaffold_6G00417590
rosa_rugosa	Rorug03G0055800
rosa_samantha	Rh3BG117600 Rh3CG120400 Rh3DG119400
rosa_wichuraiana	Rw3G009670

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	321
AclWI	GGATC	1 cut(s)	325
AcoI	YGGCCR	1 cut(s)	322
AcsI	RAATTY	1 cut(s)	358
AcuI	CTGAAG	1 cut(s)	252
AfiI	CCNNNNNNNGG	1 cut(s)	344
AjnI	CCWGG	1 cut(s)	163
AluBI	AGCT	4 cut(s)	64, 127, 161, 251
AluI	AGCT	4 cut(s)	64, 127, 161, 251
AlwI	GGATC	1 cut(s)	325
AlwNI	CAGNNNCTG	1 cut(s)	64
AoxI	GGCC	1 cut(s)	322
ApeKI	GCWGC	5 cut(s)	12, 15, 64, 244, 256
ApoI	RAATTY	1 cut(s)	358
AspLEI	GCGC	1 cut(s)	274
AspS9I	GGNCC	2 cut(s)	167, 177
AsuHPI	GGTGA	1 cut(s)	111
AvaII	GGWCC	2 cut(s)	167, 177
BbsI	GAAGAC	1 cut(s)	277
BbvI	GCAGC	5 cut(s)	24, 27, 51, 256, 268
BccI	CCATC	2 cut(s)	283, 342
BciT130I	CCWGG	1 cut(s)	165
BfaI	CTAG	1 cut(s)	128
BglI	GCCNNNNNGGC	1 cut(s)	98
BisI	GCNGC	6 cut(s)	13, 16, 65, 245, 257, 322
BlsI	GCNGC	6 cut(s)	14, 17, 66, 246, 258, 323
Bme1390I	CCNGG	1 cut(s)	165
Bme18I	GGWCC	2 cut(s)	167, 177
BmgT120I	GGNCC	2 cut(s)	167, 177
BmiI	GGNNCC	2 cut(s)	91, 179
BmrFI	CCNGG	1 cut(s)	165
BmsI	GCATC	2 cut(s)	150, 203
BpiI	GAAGAC	1 cut(s)	277
Bpu10I	CCTNAGC	1 cut(s)	123
BsaJI	CCNNGG	1 cut(s)	84
BsaXI	ACNNNNNCTCC	2 cut(s)	81, 111
Bsc4I	CCNNNNNNNGG	1 cut(s)	344
BseBI	CCWGG	1 cut(s)	165
BseDI	CCNNGG	1 cut(s)	84
BseGI	GGATG	3 cut(s)	141, 275, 334
BseLI	CCNNNNNNNGG	1 cut(s)	344
BseMII	CTCAG	1 cut(s)	114
BseRI	GAGGAG	1 cut(s)	221
BseXI	GCAGC	5 cut(s)	24, 27, 51, 256, 268
BseYI	CCCAGC	1 cut(s)	251
BshFI	GGCC	1 cut(s)	324
BslI	CCNNNNNNNGG	1 cut(s)	344
BsnI	GGCC	1 cut(s)	324
Bsp143I	GATC	1 cut(s)	330
BspACI	CCGC	1 cut(s)	321
BspANI	GGCC	1 cut(s)	324
BspCNI	CTCAG	1 cut(s)	115
BspLI	GGNNCC	2 cut(s)	91, 179
BspPI	GGATC	1 cut(s)	325
BssECI	CCNNGG	1 cut(s)	84
BssMI	GATC	1 cut(s)	330
BssT1I	CCWWGG	1 cut(s)	84
Bst2UI	CCWGG	1 cut(s)	165
Bst6I	CTCTTC	1 cut(s)	313
BstAPI	GCANNNNNTGC	1 cut(s)	24
BstC8I	GCNNGC	1 cut(s)	249
BstDEI	CTNAG	1 cut(s)	123
BstF5I	GGATG	3 cut(s)	141, 275, 334
BstHHI	GCGC	1 cut(s)	274
BstKTI	GATC	1 cut(s)	333
BstMBI	GATC	1 cut(s)	330
BstMWI	GCNNNNNNNGC	5 cut(s)	24, 98, 244, 253, 299
BstNI	CCWGG	1 cut(s)	165
BstSCI	CCNGG	1 cut(s)	163
BstV1I	GCAGC	5 cut(s)	24, 27, 51, 256, 268
BstV2I	GAAGAC	1 cut(s)	277
BstXI	CCANNNNNNTGG	1 cut(s)	341
BsuRI	GGCC	1 cut(s)	324
BtsCI	GGATG	3 cut(s)	141, 275, 334
Cac8I	GCNNGC	1 cut(s)	249
CaiI	CAGNNNCTG	1 cut(s)	64
CfoI	GCGC	1 cut(s)	274
Cfr13I	GGNCC	2 cut(s)	167, 177
CviJI	RGCY	8 cut(s)	64, 92, 127, 161, 228, 251, 259, 324
CviKI_1	RGCY	8 cut(s)	64, 92, 127, 161, 228, 251, 259, 324
DdeI	CTNAG	1 cut(s)	123
DpnI	GATC	1 cut(s)	332
DpnII	GATC	1 cut(s)	330
EaeI	YGGCCR	1 cut(s)	322
Eam1104I	CTCTTC	1 cut(s)	313
EarI	CTCTTC	1 cut(s)	313
Eco130I	CCWWGG	1 cut(s)	84
Eco47I	GGWCC	2 cut(s)	167, 177
Eco57I	CTGAAG	1 cut(s)	252
EcoRII	CCWGG	1 cut(s)	163
EcoT14I	CCWWGG	1 cut(s)	84
EcoT22I	ATGCAT	1 cut(s)	46
ErhI	CCWWGG	1 cut(s)	84
FaiI	YATR	7 cut(s)	20, 46, 75, 175, 282, 315, 317
Fnu4HI	GCNGC	6 cut(s)	13, 16, 65, 245, 257, 322
FokI	GGATG	3 cut(s)	128, 262, 321
Fsp4HI	GCNGC	6 cut(s)	13, 16, 65, 245, 257, 322
FspBI	CTAG	1 cut(s)	128
GlaI	GCGC	1 cut(s)	273
GluI	GCNGC	6 cut(s)	13, 16, 65, 245, 257, 322
GsaI	CCCAGC	1 cut(s)	255
HaeIII	GGCC	1 cut(s)	324
HhaI	GCGC	1 cut(s)	274
Hin6I	GCGC	1 cut(s)	272
HinP1I	GCGC	1 cut(s)	272
HinfI	GANTC	1 cut(s)	187
HphI	GGTGA	1 cut(s)	111
Hpy166II	GTNNAC	1 cut(s)	133
Hpy188I	TCNGA	1 cut(s)	232
Hpy188III	TCNNGA	1 cut(s)	363
Hpy8I	GTNNAC	1 cut(s)	133
HpyCH4V	TGCA	3 cut(s)	44, 218, 244
HpyF10VI	GCNNNNNNNGC	5 cut(s)	24, 98, 244, 253, 299
HpyF3I	CTNAG	1 cut(s)	123
HspAI	GCGC	1 cut(s)	272
Kzo9I	GATC	1 cut(s)	330
LmnI	GCTCC	2 cut(s)	89, 166
LpnPI	CCDG	7 cut(s)	71, 135, 150, 177, 204, 237, 274
Lsp1109I	GCAGC	5 cut(s)	24, 27, 51, 256, 268
LweI	GCATC	2 cut(s)	150, 203
MaeI	CTAG	1 cut(s)	128
MaeIII	GTNAC	1 cut(s)	117
MalI	GATC	1 cut(s)	332
MboI	GATC	1 cut(s)	330
MboII	GAAGA	2 cut(s)	277, 300
MluCI	AATT	2 cut(s)	21, 358
MnlI	CCTC	4 cut(s)	104, 199, 202, 259
Mph1103I	ATGCAT	1 cut(s)	46
MseI	TTAA	1 cut(s)	39
MslI	CAYNNNNRTG	1 cut(s)	339
MspR9I	CCNGG	1 cut(s)	165
MvaI	CCWGG	1 cut(s)	165
MwoI	GCNNNNNNNGC	5 cut(s)	24, 98, 244, 253, 299
NdeII	GATC	1 cut(s)	330
NlaIV	GGNNCC	2 cut(s)	91, 179
NmuCI	GTSAC	1 cut(s)	117
NsiI	ATGCAT	1 cut(s)	46
PfeI	GAWTC	1 cut(s)	187
PfoI	TCCNGGA	1 cut(s)	163
PkrI	GCNGC	6 cut(s)	14, 17, 66, 246, 258, 323
Psp6I	CCWGG	1 cut(s)	163
PspFI	CCCAGC	1 cut(s)	251
PspGI	CCWGG	1 cut(s)	163
PspN4I	GGNNCC	2 cut(s)	91, 179
PspPI	GGNCC	2 cut(s)	167, 177
PstNI	CAGNNNCTG	1 cut(s)	64
RseI	CAYNNNNRTG	1 cut(s)	339
SaqAI	TTAA	1 cut(s)	39
SatI	GCNGC	6 cut(s)	13, 16, 65, 245, 257, 322
Sau3AI	GATC	1 cut(s)	330
Sau96I	GGNCC	2 cut(s)	167, 177
ScrFI	CCNGG	1 cut(s)	165
SetI	ASST	6 cut(s)	66, 124, 129, 163, 253, 270
SfaNI	GCATC	2 cut(s)	150, 203
SinI	GGWCC	2 cut(s)	167, 177
SmiMI	CAYNNNNRTG	1 cut(s)	339
Sse9I	AATT	2 cut(s)	21, 358
SsiI	CCGC	1 cut(s)	321
SspMI	CTAG	1 cut(s)	128
StyD4I	CCNGG	1 cut(s)	163
StyI	CCWWGG	1 cut(s)	84
TaqI	TCGA	1 cut(s)	201
TasI	AATT	2 cut(s)	21, 358
TauI	GCSGC	1 cut(s)	324
TfiI	GAWTC	1 cut(s)	187
Tru1I	TTAA	1 cut(s)	39
Tru9I	TTAA	1 cut(s)	39
TseFI	GTSAC	1 cut(s)	117
TseI	GCWGC	5 cut(s)	12, 15, 64, 244, 256
Tsp45I	GTSAC	1 cut(s)	117
TspDTI	ATGAA	1 cut(s)	17
TspGWI	ACGGA	1 cut(s)	134
VpaK11BI	GGWCC	2 cut(s)	167, 177
XapI	RAATTY	1 cut(s)	358
XspI	CTAG	1 cut(s)	128
Zsp2I	ATGCAT	1 cut(s)	46

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.