Rorug04G0111600

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
17634802 .. 17635140
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0111600.1

Sequence Viewer

Length: 159 bp
ATGCAGTTCATGGTTGCTCCTCTTCATGCAGCAATTATAATGCAATTTCAAGATCAGAAAAGCTGGACCTCCAAAGATCTTGCAGCTGCAGTTGGGGAAGATACTGATGACCATGACTGCAACTTGGTGAGGCACAAGAAGTTGTTATGGGTTATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.97

Weight (kDa)

5.75

Isoelectric Point (pI)

15.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014714)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 38
AgsI TTSAA 1 cut(s) 50
AluBI AGCT 2 cut(s) 63, 86
AluI AGCT 2 cut(s) 63, 86
ApeKI GCWGC 3 cut(s) 29, 83, 86
AspS9I GGNCC 1 cut(s) 66
AsuHPI GGTGA 1 cut(s) 139
AvaII GGWCC 1 cut(s) 66
BbvI GCAGC 3 cut(s) 41, 73, 95
BfmI CTRYAG 1 cut(s) 87
BglII AGATCT 1 cut(s) 76
BisI GCNGC 3 cut(s) 30, 84, 87
BlsI GCNGC 3 cut(s) 31, 85, 88
Bme18I GGWCC 1 cut(s) 66
BmgT120I GGNCC 1 cut(s) 66
BseRI GAGGAG 1 cut(s) 9
BseXI GCAGC 3 cut(s) 41, 73, 95
Bsp143I GATC 2 cut(s) 52, 76
BspMAI CTGCAG 1 cut(s) 91
BssMI GATC 2 cut(s) 52, 76
Bst6I CTCTTC 1 cut(s) 27
BstKTI GATC 2 cut(s) 55, 79
BstMBI GATC 2 cut(s) 52, 76
BstSFI CTRYAG 1 cut(s) 87
BstV1I GCAGC 3 cut(s) 41, 73, 95
BstX2I RGATCY 1 cut(s) 76
BstYI RGATCY 1 cut(s) 76
Cfr13I GGNCC 1 cut(s) 66
CviAII CATG 3 cut(s) 10, 26, 113
CviJI RGCY 2 cut(s) 63, 86
CviKI_1 RGCY 2 cut(s) 63, 86
DpnI GATC 2 cut(s) 54, 78
DpnII GATC 2 cut(s) 52, 76
Eam1104I CTCTTC 1 cut(s) 27
EarI CTCTTC 1 cut(s) 27
Eco47I GGWCC 1 cut(s) 66
FaeI CATG 3 cut(s) 13, 29, 116
FaiI YATR 5 cut(s) 11, 27, 38, 114, 148
FatI CATG 3 cut(s) 9, 25, 112
Fnu4HI GCNGC 3 cut(s) 30, 84, 87
Fsp4HI GCNGC 3 cut(s) 30, 84, 87
GluI GCNGC 3 cut(s) 30, 84, 87
Hin1II CATG 3 cut(s) 13, 29, 116
HphI GGTGA 1 cut(s) 139
Hpy188I TCNGA 1 cut(s) 57
Hpy188III TCNNGA 1 cut(s) 50
HpyCH4V TGCA 6 cut(s) 4, 29, 43, 83, 89, 120
Hsp92II CATG 3 cut(s) 13, 29, 116
Kzo9I GATC 2 cut(s) 52, 76
LmnI GCTCC 1 cut(s) 22
LpnPI CCDG 1 cut(s) 49
Lsp1109I GCAGC 3 cut(s) 41, 73, 95
MalI GATC 2 cut(s) 54, 78
MboI GATC 2 cut(s) 52, 76
MboII GAAGA 2 cut(s) 14, 110
MflI RGATCY 1 cut(s) 76
MluCI AATT 2 cut(s) 33, 44
MnlI CCTC 3 cut(s) 30, 79, 123
MspA1I CMGCKG 1 cut(s) 86
NdeII GATC 2 cut(s) 52, 76
NlaIII CATG 3 cut(s) 13, 29, 116
PkrI GCNGC 3 cut(s) 31, 85, 88
PsiI TTATAA 1 cut(s) 38
PspPI GGNCC 1 cut(s) 66
PstI CTGCAG 1 cut(s) 91
PsuI RGATCY 1 cut(s) 76
PvuII CAGCTG 1 cut(s) 86
SatI GCNGC 3 cut(s) 30, 84, 87
Sau3AI GATC 2 cut(s) 52, 76
Sau96I GGNCC 1 cut(s) 66
SetI ASST 3 cut(s) 65, 71, 88
SfcI CTRYAG 1 cut(s) 87
SgeI CNNG 8 cut(s) 22, 38, 62, 76, 92, 125, 136, 148
SinI GGWCC 1 cut(s) 66
Sse9I AATT 2 cut(s) 33, 44
TasI AATT 2 cut(s) 33, 44
TseI GCWGC 3 cut(s) 29, 83, 86
TspDTI ATGAA 1 cut(s) 14
VpaK11BI GGWCC 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.