Rorug04G0291000

Protein CHUP1, chloroplastic-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
46516576 .. 46518532
1957 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0291000.1

Sequence Viewer

Length: 357 bp
ATGGCTGGACATAATGAGTCATCTGGGAAGAAATCTAGCGAGGCCACAAATGATGTTCCGACCCTGAATGCGGAGAGTTTGCAAAGTAACATGAAAATTATCTACTACAGCCGAACATTTATGTCTATCATTGGCGGGGTCATTGCTGGAATTTTGGGGTTCACCAGCCTTTCTGGATTTGTTTTGTATTTTCTTATTATGGCCATCACTTCGGTTGGACTCATTGCAAAGGCAGGGTTTCAGGTTCATTCGTATTTTGACAGCTGGAACCAGATTATACTCGATGGTGTCCTGGGTGGGCTTCTGTCGTTTGTGCTTTTCTGGACGTTTGCTTATGACATTGTGCATATATTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

12.88

Weight (kDa)

5.78

Isoelectric Point (pI)

46.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EMC6 PF07019 34 - 112 2.5e-21 EMC6
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011372)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 71, 135
AcoI YGGCCR 1 cut(s) 201
AcsI RAATTY 1 cut(s) 150
AfiI CCNNNNNNNGG 1 cut(s) 70
AjnI CCWGG 1 cut(s) 291
AluBI AGCT 1 cut(s) 264
AluI AGCT 1 cut(s) 264
AoxI GGCC 2 cut(s) 42, 201
ApoI RAATTY 1 cut(s) 150
AsuHPI GGTGA 1 cut(s) 154
BalI TGGCCA 1 cut(s) 203
BccI CCATC 2 cut(s) 212, 278
BciT130I CCWGG 1 cut(s) 293
BfaI CTAG 1 cut(s) 36
BfmI CTRYAG 1 cut(s) 106
Bme1390I CCNGG 1 cut(s) 293
BmiI GGNNCC 1 cut(s) 269
BmrFI CCNGG 1 cut(s) 293
BsaJI CCNNGG 1 cut(s) 292
Bsc4I CCNNNNNNNGG 1 cut(s) 70
Bse3DI GCAATG 2 cut(s) 141, 222
BseBI CCWGG 1 cut(s) 293
BseDI CCNNGG 1 cut(s) 292
BseLI CCNNNNNNNGG 1 cut(s) 70
BseMI GCAATG 2 cut(s) 141, 222
BshFI GGCC 2 cut(s) 44, 203
BslI CCNNNNNNNGG 1 cut(s) 70
BsmI GAATGC 1 cut(s) 73
BsnI GGCC 2 cut(s) 44, 203
BspACI CCGC 2 cut(s) 71, 135
BspANI GGCC 2 cut(s) 44, 203
BspLI GGNNCC 1 cut(s) 269
BsrDI GCAATG 2 cut(s) 141, 222
BssECI CCNNGG 1 cut(s) 292
Bst2UI CCWGG 1 cut(s) 293
BstNI CCWGG 1 cut(s) 293
BstSCI CCNGG 1 cut(s) 291
BstSFI CTRYAG 1 cut(s) 106
BsuRI GGCC 2 cut(s) 44, 203
CviAII CATG 1 cut(s) 91
CviJI RGCY 7 cut(s) 5, 44, 111, 168, 203, 264, 301
CviKI_1 RGCY 7 cut(s) 5, 44, 111, 168, 203, 264, 301
EaeI YGGCCR 1 cut(s) 201
EcoRII CCWGG 1 cut(s) 291
FaeI CATG 1 cut(s) 94
FaiI YATR 8 cut(s) 12, 92, 122, 200, 278, 336, 348, 350
FatI CATG 1 cut(s) 90
FauI CCCGC 1 cut(s) 128
FspBI CTAG 1 cut(s) 36
HaeIII GGCC 2 cut(s) 44, 203
Hin1II CATG 1 cut(s) 94
HinfI GANTC 2 cut(s) 17, 219
HphI GGTGA 1 cut(s) 154
Hpy166II GTNNAC 1 cut(s) 162
Hpy188I TCNGA 2 cut(s) 60, 356
Hpy188III TCNNGA 2 cut(s) 174, 322
Hpy8I GTNNAC 1 cut(s) 162
HpyCH4IV ACGT 1 cut(s) 326
HpyCH4V TGCA 3 cut(s) 82, 227, 346
HpySE526I ACGT 1 cut(s) 326
Hsp92II CATG 1 cut(s) 94
MaeI CTAG 1 cut(s) 36
MaeII ACGT 1 cut(s) 326
MaeIII GTNAC 1 cut(s) 86
MboII GAAGA 1 cut(s) 40
MlsI TGGCCA 1 cut(s) 203
MluCI AATT 2 cut(s) 96, 150
MluNI TGGCCA 1 cut(s) 203
MlyI GAGTC 2 cut(s) 26, 213
MmeI TCCRAC 2 cut(s) 83, 196
MnlI CCTC 1 cut(s) 34
Mox20I TGGCCA 1 cut(s) 203
MscI TGGCCA 1 cut(s) 203
Msp20I TGGCCA 1 cut(s) 203
MspA1I CMGCKG 1 cut(s) 264
MspR9I CCNGG 1 cut(s) 293
Mva1269I GAATGC 1 cut(s) 73
MvaI CCWGG 1 cut(s) 293
NlaIII CATG 1 cut(s) 94
NlaIV GGNNCC 1 cut(s) 269
PctI GAATGC 1 cut(s) 73
PleI GAGTC 2 cut(s) 25, 213
PpsI GAGTC 2 cut(s) 25, 213
Psp6I CCWGG 1 cut(s) 291
PspGI CCWGG 1 cut(s) 291
PspN4I GGNNCC 1 cut(s) 269
PvuII CAGCTG 1 cut(s) 264
SchI GAGTC 2 cut(s) 26, 213
ScrFI CCNGG 1 cut(s) 293
SetI ASST 3 cut(s) 246, 266, 329
SfcI CTRYAG 1 cut(s) 106
Sse9I AATT 2 cut(s) 96, 150
SsiI CCGC 2 cut(s) 71, 135
SspMI CTAG 1 cut(s) 36
StyD4I CCNGG 1 cut(s) 291
TaiI ACGT 1 cut(s) 329
TaqI TCGA 1 cut(s) 282
TasI AATT 2 cut(s) 96, 150
TspDTI ATGAA 2 cut(s) 107, 236
XapI RAATTY 1 cut(s) 150
XspI CTAG 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.