Rorug06G0159800

Cysteine-rich receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Forward (+)
22781069 .. 22782597
1529 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0159800.1

Sequence Viewer

Length: 363 bp
ATGGACGACGGCCTCATCTGCGATGACGATGACTTCGGTTACGATCCAGATATTTACTGCCTTGACACCTCGCTGAAAGCGTCCGATTCGTATCATGTGGACATCAATCCAGAAGTTATCTGCAATGGCACTGAAACAGTGAAACCACTGTCGGGCGATATGGAGTTCGATTCCTACGTGCTGACACCCATGGGTGGGATTACTGAGGAACAATTCGTTGAACGGTACACCATTTTTAAAGGCCTATATCAACATCATCCTGAGCTTCAGGCGTTGCCCTGTTTTATTAGGTTTTATGATGTAAGTAATCTTATTGTTGTTGCTATTATTCCACCTTTGTTTTTCTCATCTTCCTACTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.61

Weight (kDa)

4.05

Isoelectric Point (pI)

30.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018964)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 38
AcuI CTGAAG 1 cut(s) 251
AfaI GTAC 1 cut(s) 227
AfiI CCNNNNNNNGG 3 cut(s) 152, 194, 195
AgsI TTSAA 1 cut(s) 221
AluBI AGCT 1 cut(s) 265
AluI AGCT 1 cut(s) 265
AlwI GGATC 1 cut(s) 38
AoxI GGCC 2 cut(s) 10, 241
ArsI GACNNNNNNTTYG 2 cut(s) 17, 49
BceAI ACGGC 1 cut(s) 25
Bpu10I CCTNAGC 1 cut(s) 261
BsaAI YACGTR 1 cut(s) 178
BsaBI GATNNNNATC 1 cut(s) 90
BsaJI CCNNGG 1 cut(s) 189
Bsc4I CCNNNNNNNGG 3 cut(s) 152, 194, 195
Bse3DI GCAATG 1 cut(s) 130
Bse8I GATNNNNATC 1 cut(s) 90
BseDI CCNNGG 1 cut(s) 189
BseGI GGATG 1 cut(s) 256
BseJI GATNNNNATC 1 cut(s) 90
BseLI CCNNNNNNNGG 3 cut(s) 152, 194, 195
BseMI GCAATG 1 cut(s) 130
BseMII CTCAG 2 cut(s) 195, 252
BshFI GGCC 2 cut(s) 12, 243
BslI CCNNNNNNNGG 3 cut(s) 152, 194, 195
BsnI GGCC 2 cut(s) 12, 243
Bsp143I GATC 1 cut(s) 43
Bsp19I CCATGG 1 cut(s) 189
BspANI GGCC 2 cut(s) 12, 243
BspCNI CTCAG 2 cut(s) 196, 253
BspPI GGATC 1 cut(s) 38
BsrDI GCAATG 1 cut(s) 130
BssECI CCNNGG 1 cut(s) 189
BssMI GATC 1 cut(s) 43
BssT1I CCWWGG 1 cut(s) 189
Bst4CI ACNGT 3 cut(s) 139, 150, 225
BstBAI YACGTR 1 cut(s) 178
BstDEI CTNAG 2 cut(s) 204, 261
BstDSI CCRYGG 1 cut(s) 189
BstF5I GGATG 1 cut(s) 256
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BstMWI GCNNNNNNNGC 1 cut(s) 18
BsuRI GGCC 2 cut(s) 12, 243
BtgI CCRYGG 1 cut(s) 189
BtgZI GCGATG 1 cut(s) 36
BtsCI GGATG 1 cut(s) 256
BtsIMutI CAGTG 3 cut(s) 129, 144, 146
CseI GACGC 1 cut(s) 69
Csp6I GTAC 1 cut(s) 226
CviAII CATG 2 cut(s) 95, 190
CviJI RGCY 3 cut(s) 12, 243, 265
CviKI_1 RGCY 3 cut(s) 12, 243, 265
CviQI GTAC 1 cut(s) 226
DdeI CTNAG 2 cut(s) 204, 261
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
DraI TTTAAA 1 cut(s) 238
Eco130I CCWWGG 1 cut(s) 189
Eco147I AGGCCT 1 cut(s) 243
Eco57I CTGAAG 1 cut(s) 251
EcoT14I CCWWGG 1 cut(s) 189
ErhI CCWWGG 1 cut(s) 189
FaeI CATG 2 cut(s) 98, 193
FaiI YATR 5 cut(s) 96, 161, 191, 247, 297
FatI CATG 2 cut(s) 94, 189
FokI GGATG 1 cut(s) 243
HaeIII GGCC 2 cut(s) 12, 243
HgaI GACGC 1 cut(s) 69
Hin1II CATG 2 cut(s) 98, 193
HinfI GANTC 2 cut(s) 86, 170
Hpy166II GTNNAC 2 cut(s) 100, 228
Hpy188I TCNGA 1 cut(s) 85
Hpy188III TCNNGA 3 cut(s) 47, 110, 260
Hpy8I GTNNAC 2 cut(s) 100, 228
Hpy99I CGWCG 1 cut(s) 11
HpyCH4III ACNGT 3 cut(s) 139, 150, 225
HpyCH4IV ACGT 1 cut(s) 177
HpyCH4V TGCA 1 cut(s) 123
HpyF10VI GCNNNNNNNGC 1 cut(s) 18
HpyF3I CTNAG 2 cut(s) 204, 261
HpySE526I ACGT 1 cut(s) 177
Hsp92II CATG 2 cut(s) 98, 193
Kzo9I GATC 1 cut(s) 43
LpnPI CCDG 5 cut(s) 60, 123, 254, 273, 292
MaeII ACGT 1 cut(s) 177
MaeIII GTNAC 1 cut(s) 38
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MboII GAAGA 1 cut(s) 342
MluCI AATT 1 cut(s) 212
MnlI CCTC 3 cut(s) 23, 79, 199
MseI TTAA 1 cut(s) 237
MwoI GCNNNNNNNGC 1 cut(s) 18
NcoI CCATGG 1 cut(s) 189
NdeII GATC 1 cut(s) 43
NlaIII CATG 2 cut(s) 98, 193
PceI AGGCCT 1 cut(s) 243
PcsI WCGNNNNNNNCGW 2 cut(s) 77, 174
PfeI GAWTC 2 cut(s) 86, 170
Ppu21I YACGTR 1 cut(s) 178
RsaI GTAC 1 cut(s) 227
RsaNI GTAC 1 cut(s) 226
SaqAI TTAA 1 cut(s) 237
Sau3AI GATC 1 cut(s) 43
SetI ASST 5 cut(s) 71, 180, 267, 293, 337
Sse9I AATT 1 cut(s) 212
SseBI AGGCCT 1 cut(s) 243
StuI AGGCCT 1 cut(s) 243
StyI CCWWGG 1 cut(s) 189
TaaI ACNGT 3 cut(s) 139, 150, 225
TaiI ACGT 1 cut(s) 180
TaqI TCGA 1 cut(s) 168
TasI AATT 1 cut(s) 212
TfiI GAWTC 2 cut(s) 86, 170
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
TscAI CASTG 3 cut(s) 136, 144, 153
TspRI CASTG 3 cut(s) 136, 144, 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.