Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000007

Orthogroup ID

OG0006474

Physical Location & Seq

Genomic Coordinates Reverse (-)

2814052 .. 2814246

Gene Structure 195 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug07G0039900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 195 bp

ATGTCAGAAGCTTTAGCCCTGCGAGCTAGTCTTCGTGCTATCTTATTACATGGCTTTCATTATTTGGAAGTAGAAGATGATTCGAAACTGTTGATTGATAGTTTTCATAGATCTATACATCCTCCTTGGCGTATCAAAAAAAATCCTCAAAGACATTCCATAGTTGTCATCTCAACTCCACAACTTAAGCCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000323 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005764 GO:0005765 GO:0005768 GO:0005773 GO:0005774 GO:0005783 GO:0005789 GO:0005798 GO:0012505 GO:0016020 GO:0016021 GO:0030176 GO:0030660 GO:0031090 GO:0031224 GO:0031227 GO:0031410 GO:0031982 GO:0031984 GO:0042175 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044433 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0071458 GO:0071556 GO:0097708 GO:0098552 GO:0098553 GO:0098554 GO:0098562 GO:0098588 GO:0098805 GO:0098827 GO:0098852

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PA Peptidase_A22B

Protein Analysis

64

Amino Acids

7.41

Weight (kDa)

9.81

Isoelectric Point (pI)

56.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006474)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G63690 AT1G63690
fragaria_vesca	FvH4_5g02620 FvH4_5g02620 FvH4_5g02620
malus_domestica	MD06G1085300.v1.1 MD14G1106400.v1.1
prunus_persica	Prupe.5G101300_v2.0.a1 Prupe.5G101300_v2.0.a1 Prupe.5G101300_v2.0.a1
pyrus_communis	pycom06g08140 pycom14g10140
rosa_chinensis	RchiOBHm_Chr7g0197471
rosa_laevigata	RLG00000003938
rosa_multiflora	Rmu_sc0013361.1_g000002
rosa_roxburghii	Rroxscaffold_3G00258440
rosa_rugosa	Rorug07G0039800 Rorug07G0039900 Rorug07G0040000 Rorug07G0040000 Rorug07G0040000
rosa_samantha	Rh7AG164900 Rh7BG167100 Rh7CG173400 Rh7DG166400
rosa_wichuraiana	Rw7G014380

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AflII	CTTAAG	1 cut(s)	185
AluBI	AGCT	2 cut(s)	11, 26
AluI	AGCT	2 cut(s)	11, 26
AsuII	TTCGAA	1 cut(s)	83
BbsI	GAAGAC	1 cut(s)	23
BfaI	CTAG	1 cut(s)	27
BfrI	CTTAAG	1 cut(s)	185
BglII	AGATCT	1 cut(s)	110
BpiI	GAAGAC	1 cut(s)	23
Bpu14I	TTCGAA	1 cut(s)	83
BsaJI	CCNNGG	1 cut(s)	125
BseDI	CCNNGG	1 cut(s)	125
BseGI	GGATG	1 cut(s)	118
Bsp119I	TTCGAA	1 cut(s)	83
Bsp143I	GATC	1 cut(s)	110
BspT104I	TTCGAA	1 cut(s)	83
BspTI	CTTAAG	1 cut(s)	185
BssECI	CCNNGG	1 cut(s)	125
BssMI	GATC	1 cut(s)	110
BssT1I	CCWWGG	1 cut(s)	125
Bst4CI	ACNGT	1 cut(s)	90
BstAFI	CTTAAG	1 cut(s)	185
BstBI	TTCGAA	1 cut(s)	83
BstC8I	GCNNGC	1 cut(s)	24
BstF5I	GGATG	1 cut(s)	118
BstKTI	GATC	1 cut(s)	113
BstMBI	GATC	1 cut(s)	110
BstMWI	GCNNNNNNNGC	1 cut(s)	23
BstV2I	GAAGAC	1 cut(s)	23
BstX2I	RGATCY	1 cut(s)	110
BstYI	RGATCY	1 cut(s)	110
BtsCI	GGATG	1 cut(s)	118
Cac8I	GCNNGC	1 cut(s)	24
CviAII	CATG	1 cut(s)	50
CviJI	RGCY	5 cut(s)	11, 17, 26, 54, 190
CviKI_1	RGCY	5 cut(s)	11, 17, 26, 54, 190
DpnI	GATC	1 cut(s)	112
DpnII	GATC	1 cut(s)	110
Eco130I	CCWWGG	1 cut(s)	125
EcoT14I	CCWWGG	1 cut(s)	125
ErhI	CCWWGG	1 cut(s)	125
FaeI	CATG	1 cut(s)	53
FaiI	YATR	4 cut(s)	51, 108, 116, 161
FatI	CATG	1 cut(s)	49
FokI	GGATG	1 cut(s)	105
FspBI	CTAG	1 cut(s)	27
FspEI	CC	9 cut(s)	31, 32, 36, 50, 112, 135, 138, 159, 172
Hin1II	CATG	1 cut(s)	53
HindIII	AAGCTT	1 cut(s)	9
HinfI	GANTC	1 cut(s)	80
Hpy188I	TCNGA	1 cut(s)	7
HpyCH4III	ACNGT	1 cut(s)	90
HpyF10VI	GCNNNNNNNGC	1 cut(s)	23
Hsp92II	CATG	1 cut(s)	53
Kzo9I	GATC	1 cut(s)	110
LpnPI	CCDG	1 cut(s)	32
MaeI	CTAG	1 cut(s)	27
MalI	GATC	1 cut(s)	112
MboI	GATC	1 cut(s)	110
MboII	GAAGA	2 cut(s)	23, 86
MflI	RGATCY	1 cut(s)	110
MnlI	CCTC	2 cut(s)	132, 156
MseI	TTAA	2 cut(s)	186, 193
MspCI	CTTAAG	1 cut(s)	185
MwoI	GCNNNNNNNGC	1 cut(s)	23
NdeII	GATC	1 cut(s)	110
NlaIII	CATG	1 cut(s)	53
NspV	TTCGAA	1 cut(s)	83
PfeI	GAWTC	1 cut(s)	80
PsuI	RGATCY	1 cut(s)	110
SaqAI	TTAA	2 cut(s)	186, 193
Sau3AI	GATC	1 cut(s)	110
SetI	ASST	2 cut(s)	13, 28
SfuI	TTCGAA	1 cut(s)	83
SgeI	CNNG	6 cut(s)	31, 35, 39, 47, 62, 138
SmlI	CTYRAG	1 cut(s)	185
SmoI	CTYRAG	1 cut(s)	185
SspMI	CTAG	1 cut(s)	27
StyI	CCWWGG	1 cut(s)	125
TaaI	ACNGT	1 cut(s)	90
TaqI	TCGA	1 cut(s)	83
TfiI	GAWTC	1 cut(s)	80
Tru1I	TTAA	2 cut(s)	186, 193
Tru9I	TTAA	2 cut(s)	186, 193
TspDTI	ATGAA	2 cut(s)	47, 95
Vha464I	CTTAAG	1 cut(s)	185
XspI	CTAG	1 cut(s)	27

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.