Rh1BG029900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
4026026 .. 4037372
11347 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG029900.1

Sequence Viewer

Length: 357 bp
ATGCAAGAAACCAAGAATAGAAGGAATGATTCTAAGGAACAAACTGTGGGAAATTCCAATAGAATTGTCGATGAGAATGCCAATTTAGATAAAAGCAAAATTACCTCAGAGACTATTCTAGGATTGGGAACTATCATTTTGAAGCATGGTTCAAAGTTTGAGAAGCAGATCGAGAAGGCAAAGGAAAACTCAAGAGGAGATTGTGAAACACCTCGGAAGAATTCTGAGAGAAACAAAACATCATCTGAGACTATTCACAACTTGGAAAACTCTCAATCAATTCATGATGAAGCTACCCCCAATGCTTTTCTCAAGTTTAGGCATCTTAGCTTAAGATCTTGGGATTCAATTAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.48

Weight (kDa)

9.1

Isoelectric Point (pI)

48.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 52, 220
AflII CTTAAG 1 cut(s) 331
AgsI TTSAA 3 cut(s) 142, 153, 348
AluBI AGCT 2 cut(s) 293, 330
AluI AGCT 2 cut(s) 293, 330
Alw26I GTCTC 2 cut(s) 104, 242
ApoI RAATTY 2 cut(s) 52, 220
BcgI CGANNNNNNTGC 2 cut(s) 59, 93
BcoDI GTCTC 2 cut(s) 104, 242
BfaI CTAG 1 cut(s) 119
BfrI CTTAAG 1 cut(s) 331
BglII AGATCT 1 cut(s) 335
BmsI GCATC 1 cut(s) 331
BpuEI CTTGAG 2 cut(s) 175, 296
BsaJI CCNNGG 1 cut(s) 212
BseDI CCNNGG 1 cut(s) 212
BseMII CTCAG 3 cut(s) 120, 216, 237
BseRI GAGGAG 1 cut(s) 210
BsmAI GTCTC 2 cut(s) 104, 242
BsmI GAATGC 1 cut(s) 82
Bsp143I GATC 2 cut(s) 168, 335
BspCNI CTCAG 3 cut(s) 119, 217, 238
BspHI TCATGA 1 cut(s) 283
BspTI CTTAAG 1 cut(s) 331
BssECI CCNNGG 1 cut(s) 212
BssMI GATC 2 cut(s) 168, 335
Bst4CI ACNGT 1 cut(s) 46
BstAFI CTTAAG 1 cut(s) 331
BstDEI CTNAG 5 cut(s) 33, 106, 225, 246, 326
BstKTI GATC 2 cut(s) 171, 338
BstMAI GTCTC 2 cut(s) 104, 242
BstMBI GATC 2 cut(s) 168, 335
BstX2I RGATCY 1 cut(s) 335
BstYI RGATCY 1 cut(s) 335
CciI TCATGA 1 cut(s) 283
CviAII CATG 2 cut(s) 146, 284
CviJI RGCY 2 cut(s) 293, 330
CviKI_1 RGCY 2 cut(s) 293, 330
DdeI CTNAG 5 cut(s) 33, 106, 225, 246, 326
DpnI GATC 2 cut(s) 170, 337
DpnII GATC 2 cut(s) 168, 335
EcoRI GAATTC 1 cut(s) 220
FaeI CATG 2 cut(s) 149, 287
FaiI YATR 2 cut(s) 147, 285
FatI CATG 2 cut(s) 145, 283
FspBI CTAG 1 cut(s) 119
Hin1II CATG 2 cut(s) 149, 287
HinfI GANTC 2 cut(s) 29, 344
Hpy188I TCNGA 4 cut(s) 109, 216, 226, 247
Hpy188III TCNNGA 3 cut(s) 172, 192, 284
HpyAV CCTTC 2 cut(s) 15, 169
HpyCH4III ACNGT 1 cut(s) 46
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 5 cut(s) 33, 106, 225, 246, 326
Hsp92II CATG 2 cut(s) 149, 287
Kzo9I GATC 2 cut(s) 168, 335
LweI GCATC 1 cut(s) 331
MaeI CTAG 1 cut(s) 119
MalI GATC 2 cut(s) 170, 337
MboI GATC 2 cut(s) 168, 335
MboII GAAGA 1 cut(s) 229
MflI RGATCY 1 cut(s) 335
MluCI AATT 7 cut(s) 52, 63, 82, 99, 220, 279, 348
MnlI CCTC 3 cut(s) 115, 188, 222
MseI TTAA 2 cut(s) 332, 351
MspCI CTTAAG 1 cut(s) 331
Mva1269I GAATGC 1 cut(s) 82
NdeII GATC 2 cut(s) 168, 335
NlaIII CATG 2 cut(s) 149, 287
PagI TCATGA 1 cut(s) 283
PctI GAATGC 1 cut(s) 82
PfeI GAWTC 2 cut(s) 29, 344
PsuI RGATCY 1 cut(s) 335
SaqAI TTAA 2 cut(s) 332, 351
Sau3AI GATC 2 cut(s) 168, 335
SetI ASST 4 cut(s) 107, 214, 295, 332
SfaNI GCATC 1 cut(s) 331
SmlI CTYRAG 3 cut(s) 190, 311, 331
SmoI CTYRAG 3 cut(s) 190, 311, 331
Sse9I AATT 7 cut(s) 52, 63, 82, 99, 220, 279, 348
SspMI CTAG 1 cut(s) 119
TaaI ACNGT 1 cut(s) 46
TaqI TCGA 2 cut(s) 69, 171
TasI AATT 7 cut(s) 52, 63, 82, 99, 220, 279, 348
TfiI GAWTC 2 cut(s) 29, 344
Tru1I TTAA 2 cut(s) 332, 351
Tru9I TTAA 2 cut(s) 332, 351
TspDTI ATGAA 2 cut(s) 272, 303
Vha464I CTTAAG 1 cut(s) 331
XapI RAATTY 2 cut(s) 52, 220
XspI CTAG 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.