Rh1BG099400

ATP-dependent microtubule motor activity, plus-end-directed

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
17390481 .. 17391137
657 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG099400.1

Sequence Viewer

Length: 222 bp
ATGCACTATGCCAGGAAATATGTAGCTATTGCACAAAAGAACAAAGGGCGAAAGGTCAGTATGATGCAAGCTGAAAATAAAGCTCTTGCTGACTTTCCAGAGTGGTATGCCACACATGTAAATGGATTGCAGCTTCAAGGTGATCCTAGTGCAACTGAAGACCTTGTTGCTTTGGCAAATGGACCAAGAAAAACTTGCTACAGGTACAAAATATGTAAGTAA

Protein Analysis

73

Amino Acids

8.29

Weight (kDa)

9.55

Isoelectric Point (pI)

40.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019329)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 137
AcuI CTGAAG 1 cut(s) 177
AfaI GTAC 1 cut(s) 206
AflIII ACRYGT 1 cut(s) 115
AgsI TTSAA 1 cut(s) 137
AjnI CCWGG 1 cut(s) 11
AluBI AGCT 4 cut(s) 26, 71, 83, 133
AluI AGCT 4 cut(s) 26, 71, 83, 133
AlwI GGATC 1 cut(s) 137
ApeKI GCWGC 1 cut(s) 130
AspS9I GGNCC 1 cut(s) 182
AsuHPI GGTGA 1 cut(s) 152
AvaII GGWCC 1 cut(s) 182
BbsI GAAGAC 1 cut(s) 165
BbvI GCAGC 1 cut(s) 142
BciT130I CCWGG 1 cut(s) 13
BfaI CTAG 1 cut(s) 147
BfmI CTRYAG 1 cut(s) 199
BisI GCNGC 1 cut(s) 131
BlsI GCNGC 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 13
Bme18I GGWCC 1 cut(s) 182
BmgT120I GGNCC 1 cut(s) 182
BmrFI CCNGG 1 cut(s) 13
BmsI GCATC 1 cut(s) 54
BpiI GAAGAC 1 cut(s) 165
BseBI CCWGG 1 cut(s) 13
BseXI GCAGC 1 cut(s) 142
Bsp143I GATC 1 cut(s) 142
BspPI GGATC 1 cut(s) 137
BssMI GATC 1 cut(s) 142
Bst2UI CCWGG 1 cut(s) 13
BstC8I GCNNGC 1 cut(s) 69
BstKTI GATC 1 cut(s) 145
BstMBI GATC 1 cut(s) 142
BstNI CCWGG 1 cut(s) 13
BstNSI RCATGY 1 cut(s) 119
BstSCI CCNGG 1 cut(s) 11
BstSFI CTRYAG 1 cut(s) 199
BstV1I GCAGC 1 cut(s) 142
BstV2I GAAGAC 1 cut(s) 165
Cac8I GCNNGC 1 cut(s) 69
Cfr13I GGNCC 1 cut(s) 182
Csp6I GTAC 1 cut(s) 205
CviAII CATG 1 cut(s) 116
CviJI RGCY 4 cut(s) 26, 71, 83, 133
CviKI_1 RGCY 4 cut(s) 26, 71, 83, 133
CviQI GTAC 1 cut(s) 205
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
Eco47I GGWCC 1 cut(s) 182
Eco57I CTGAAG 1 cut(s) 177
EcoRII CCWGG 1 cut(s) 11
FaeI CATG 1 cut(s) 119
FaiI YATR 6 cut(s) 9, 21, 62, 108, 117, 214
FalI AAGNNNNNCTT 2 cut(s) 178, 210
FatI CATG 1 cut(s) 115
Fnu4HI GCNGC 1 cut(s) 131
Fsp4HI GCNGC 1 cut(s) 131
FspBI CTAG 1 cut(s) 147
GluI GCNGC 1 cut(s) 131
Hin1II CATG 1 cut(s) 119
HphI GGTGA 1 cut(s) 152
Hpy188III TCNNGA 1 cut(s) 98
HpyCH4V TGCA 5 cut(s) 4, 32, 67, 130, 152
Hsp92II CATG 1 cut(s) 119
Kzo9I GATC 1 cut(s) 142
LpnPI CCDG 3 cut(s) 25, 111, 187
Lsp1109I GCAGC 1 cut(s) 142
LweI GCATC 1 cut(s) 54
MaeI CTAG 1 cut(s) 147
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 1 cut(s) 170
MslI CAYNNNNRTG 1 cut(s) 120
MspR9I CCNGG 1 cut(s) 13
MvaI CCWGG 1 cut(s) 13
NdeII GATC 1 cut(s) 142
NlaIII CATG 1 cut(s) 119
NspI RCATGY 1 cut(s) 119
PciI ACATGT 1 cut(s) 115
PkrI GCNGC 1 cut(s) 132
PscI ACATGT 1 cut(s) 115
Psp6I CCWGG 1 cut(s) 11
PspGI CCWGG 1 cut(s) 11
PspPI GGNCC 1 cut(s) 182
RsaI GTAC 1 cut(s) 206
RsaNI GTAC 1 cut(s) 205
RseI CAYNNNNRTG 1 cut(s) 120
SatI GCNGC 1 cut(s) 131
Sau3AI GATC 1 cut(s) 142
Sau96I GGNCC 1 cut(s) 182
ScrFI CCNGG 1 cut(s) 13
SetI ASST 8 cut(s) 28, 57, 73, 85, 135, 142, 165, 206
SfaNI GCATC 1 cut(s) 54
SfcI CTRYAG 1 cut(s) 199
SinI GGWCC 1 cut(s) 182
SmiMI CAYNNNNRTG 1 cut(s) 120
SspMI CTAG 1 cut(s) 147
StyD4I CCNGG 1 cut(s) 11
TseI GCWGC 1 cut(s) 130
VpaK11BI GGWCC 1 cut(s) 182
XceI RCATGY 1 cut(s) 119
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.