Rh3CG254500

DNA-directed primase polymerase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
24818482 .. 24821813
3332 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG254500.1

Sequence Viewer

Length: 345 bp
ATGCATTGTTGTCAGGATTTACCATGCCACCTTTATTTTGACCTGGAGTTGAATAAGAAAGACAATGGAAACAGAAATGGAGATGAAATGGTTGATCTTTTAATATCAGTTGTTTTTGAAGCCTTGCTTGAAAAGTATTCTATTCAGGGGAACATGGAATGGATATTGGAACTTGATTCCTCTACTGAAGCAAAGTTCTCTCGACATTTAATTATTCGCATTCAGAAGACTGCTTTTAAGGACAACTCACATGTAGGTGCATTTGTCACTGAGATGAGTGCTCCCTGCTTGGATGGGGTTGAAGATCACCTAGTTACGTCACTAGGTGCAGACTTTGACACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

12.89

Weight (kDa)

4.6

Isoelectric Point (pI)

30.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019329)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 207
AdeI CACNNNGTG 1 cut(s) 326
AflIII ACRYGT 1 cut(s) 250
AgsI TTSAA 4 cut(s) 52, 119, 131, 302
AjnI CCWGG 1 cut(s) 42
Alw21I GWGCWC 1 cut(s) 283
AsuHPI GGTGA 1 cut(s) 299
BbsI GAAGAC 1 cut(s) 233
Bbv12I GWGCWC 1 cut(s) 283
BccI CCATC 1 cut(s) 287
BciT130I CCWGG 1 cut(s) 44
BfaI CTAG 2 cut(s) 311, 323
Bme1390I CCNGG 1 cut(s) 44
BmrFI CCNGG 1 cut(s) 44
BpiI GAAGAC 1 cut(s) 233
BpmI CTGGAG 1 cut(s) 65
BseBI CCWGG 1 cut(s) 44
BseGI GGATG 1 cut(s) 298
BseMII CTCAG 1 cut(s) 261
BsiHKAI GWGCWC 1 cut(s) 283
BsmI GAATGC 1 cut(s) 219
Bsp1286I GDGCHC 1 cut(s) 283
Bsp143I GATC 2 cut(s) 94, 304
BspCNI CTCAG 1 cut(s) 262
BssMI GATC 2 cut(s) 94, 304
Bst2UI CCWGG 1 cut(s) 44
BstDEI CTNAG 1 cut(s) 270
BstF5I GGATG 1 cut(s) 298
BstKTI GATC 2 cut(s) 97, 307
BstMBI GATC 2 cut(s) 94, 304
BstNI CCWGG 1 cut(s) 44
BstNSI RCATGY 1 cut(s) 254
BstSCI CCNGG 1 cut(s) 42
BstV2I GAAGAC 1 cut(s) 233
BtsCI GGATG 1 cut(s) 298
BtsIMutI CAGTG 1 cut(s) 267
CviAII CATG 3 cut(s) 24, 154, 251
CviJI RGCY 1 cut(s) 122
CviKI_1 RGCY 1 cut(s) 122
DdeI CTNAG 1 cut(s) 270
DpnI GATC 2 cut(s) 96, 306
DpnII GATC 2 cut(s) 94, 304
DraIII CACNNNGTG 1 cut(s) 326
Eco57I CTGAAG 1 cut(s) 207
EcoRII CCWGG 1 cut(s) 42
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 3 cut(s) 27, 157, 254
FaiI YATR 3 cut(s) 25, 155, 252
FalI AAGNNNNNCTT 2 cut(s) 111, 143
FatI CATG 3 cut(s) 23, 153, 250
FokI GGATG 1 cut(s) 305
FspBI CTAG 2 cut(s) 311, 323
GsuI CTGGAG 1 cut(s) 65
Hin1II CATG 3 cut(s) 27, 157, 254
HinfI GANTC 1 cut(s) 176
HphI GGTGA 1 cut(s) 299
Hpy188I TCNGA 1 cut(s) 225
Hpy188III TCNNGA 2 cut(s) 14, 201
HpyCH4IV ACGT 1 cut(s) 317
HpyCH4V TGCA 3 cut(s) 4, 260, 329
HpyF3I CTNAG 1 cut(s) 270
HpySE526I ACGT 1 cut(s) 317
Hsp92II CATG 3 cut(s) 27, 157, 254
Kzo9I GATC 2 cut(s) 94, 304
LmnI GCTCC 1 cut(s) 286
LpnPI CCDG 4 cut(s) 29, 56, 131, 298
MaeI CTAG 2 cut(s) 311, 323
MaeII ACGT 1 cut(s) 317
MaeIII GTNAC 3 cut(s) 265, 313, 318
MalI GATC 2 cut(s) 96, 306
MboI GATC 2 cut(s) 94, 304
MboII GAAGA 2 cut(s) 238, 314
MhlI GDGCHC 1 cut(s) 283
MluCI AATT 1 cut(s) 210
MnlI CCTC 1 cut(s) 190
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 4 cut(s) 101, 209, 237, 343
MslI CAYNNNNRTG 2 cut(s) 255, 272
MspR9I CCNGG 1 cut(s) 44
Mva1269I GAATGC 1 cut(s) 219
MvaI CCWGG 1 cut(s) 44
NdeII GATC 2 cut(s) 94, 304
NlaIII CATG 3 cut(s) 27, 157, 254
NmuCI GTSAC 2 cut(s) 265, 318
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 254
PciI ACATGT 1 cut(s) 250
PctI GAATGC 1 cut(s) 219
PfeI GAWTC 1 cut(s) 176
PscI ACATGT 1 cut(s) 250
Psp6I CCWGG 1 cut(s) 42
PspGI CCWGG 1 cut(s) 42
RseI CAYNNNNRTG 2 cut(s) 255, 272
SaqAI TTAA 4 cut(s) 101, 209, 237, 343
Sau3AI GATC 2 cut(s) 94, 304
ScrFI CCNGG 1 cut(s) 44
SduI GDGCHC 1 cut(s) 283
SetI ASST 6 cut(s) 33, 45, 259, 312, 320, 328
SmiMI CAYNNNNRTG 2 cut(s) 255, 272
Sse9I AATT 1 cut(s) 210
SspMI CTAG 2 cut(s) 311, 323
StyD4I CCNGG 1 cut(s) 42
TaiI ACGT 1 cut(s) 320
TaqI TCGA 1 cut(s) 202
TasI AATT 1 cut(s) 210
TfiI GAWTC 1 cut(s) 176
Tru1I TTAA 4 cut(s) 101, 209, 237, 343
Tru9I TTAA 4 cut(s) 101, 209, 237, 343
TscAI CASTG 1 cut(s) 274
TseFI GTSAC 2 cut(s) 265, 318
Tsp45I GTSAC 2 cut(s) 265, 318
TspDTI ATGAA 1 cut(s) 99
TspRI CASTG 1 cut(s) 274
XceI RCATGY 1 cut(s) 254
XspI CTAG 2 cut(s) 311, 323
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.