Rh1BG406000

May be involved in fusion of retrograde transport vesicles derived from an endocytic compartment with the Golgi complex

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0013960
Physical Location & Seq
Forward (+)
52804843 .. 52808228
3386 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG406000.1

Sequence Viewer

Length: 381 bp
ATGTATGCGTTTGGAGGTTGTTTGTTGGCTGGGATGGTCTGTATGTTCTTGTCGATGATTGTATTTGCCAAACCCATCAAATTTGCCATTTTGTTCACCTTTGGCAATTTGTTGGCGGTTGGAAGCACAGCTTTCCTCTTTGGCCCTGCCCAACAAATACGAATGATGTTTGACACAATCCGAATTTATGCAACAGCTATTTACCTTGGATGTGTTGTTTTAGCACTCGTCTGTGCTCTCTTGATTCAAAGCAAAGTTTTGACACTAATTGCAATGATATGTGAGATCTGTGCCCTTATTTGGTACAGTCTGAGTTATATTCCTTTTGCTCGAAGAATGGTTTCAGAATTGATGATTCGTTTATGCGACACCGAGCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0006810 GO:0008150 GO:0016020 GO:0016192 GO:0051179 GO:0051234
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Got1

Protein Analysis

126

Amino Acids

14.02

Weight (kDa)

8.53

Isoelectric Point (pI)

35.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Got1 PF04178 1 - 108 3.2e-33 Got1/Sft2-like family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013960)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G24170 AT5G24170
fragaria_vesca FvH4_7g31760
malus_domestica MD01G1219600.v1.1
prunus_persica Prupe.2G311600_v2.0.a1 Prupe.2G311600_v2.0.a1 Prupe.2G311600_v2.0.a1 Prupe.2G311600_v2.0.a1
pyrus_communis pycom01g22940
rosa_chinensis RchiOBHm_Chr1g0380991
rosa_laevigata RLG00000026254
rosa_roxburghii Rroxscaffold_4G00278880
rosa_rugosa Rorug01G0426200
rosa_samantha Rh1BG406000 Rh1CG420000 Rh1DG436500
rosa_wichuraiana Rw1G039210

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 116
AcsI RAATTY 2 cut(s) 80, 183
AfaI GTAC 1 cut(s) 305
AfiI CCNNNNNNNGG 1 cut(s) 300
AgsI TTSAA 1 cut(s) 248
AluBI AGCT 3 cut(s) 131, 197, 376
AluI AGCT 3 cut(s) 131, 197, 376
Alw21I GWGCWC 1 cut(s) 238
AoxI GGCC 1 cut(s) 142
ApoI RAATTY 2 cut(s) 80, 183
Asp700I GAANNNNTTC 1 cut(s) 340
AspS9I GGNCC 1 cut(s) 143
AsuHPI GGTGA 1 cut(s) 88
BaeGI GKGCMC 1 cut(s) 295
Bbv12I GWGCWC 1 cut(s) 238
BccI CCATC 2 cut(s) 28, 83
BglII AGATCT 1 cut(s) 285
BmgT120I GGNCC 1 cut(s) 143
BsaJI CCNNGG 1 cut(s) 205
Bsc4I CCNNNNNNNGG 1 cut(s) 300
Bse3DI GCAATG 1 cut(s) 279
BseDI CCNNGG 1 cut(s) 205
BseGI GGATG 2 cut(s) 39, 215
BseLI CCNNNNNNNGG 1 cut(s) 300
BseMI GCAATG 1 cut(s) 279
BseMII CTCAG 1 cut(s) 302
BseSI GKGCMC 1 cut(s) 295
BseYI CCCAGC 1 cut(s) 29
BshFI GGCC 1 cut(s) 144
BsiHKAI GWGCWC 1 cut(s) 238
BslI CCNNNNNNNGG 1 cut(s) 300
BsnI GGCC 1 cut(s) 144
Bsp1286I GDGCHC 2 cut(s) 238, 295
Bsp143I GATC 1 cut(s) 285
BspACI CCGC 1 cut(s) 116
BspANI GGCC 1 cut(s) 144
BspCNI CTCAG 1 cut(s) 303
BsrDI GCAATG 1 cut(s) 279
BssECI CCNNGG 1 cut(s) 205
BssMI GATC 1 cut(s) 285
BssT1I CCWWGG 1 cut(s) 205
Bst4CI ACNGT 1 cut(s) 308
BstDEI CTNAG 1 cut(s) 311
BstF5I GGATG 2 cut(s) 39, 215
BstKTI GATC 1 cut(s) 288
BstMBI GATC 1 cut(s) 285
BstSLI GKGCMC 1 cut(s) 295
BstX2I RGATCY 1 cut(s) 285
BstYI RGATCY 1 cut(s) 285
BsuRI GGCC 1 cut(s) 144
BtsCI GGATG 2 cut(s) 39, 215
Cfr13I GGNCC 1 cut(s) 143
Csp6I GTAC 1 cut(s) 304
CviJI RGCY 5 cut(s) 29, 131, 144, 197, 376
CviKI_1 RGCY 5 cut(s) 29, 131, 144, 197, 376
CviQI GTAC 1 cut(s) 304
DdeI CTNAG 1 cut(s) 311
DpnI GATC 1 cut(s) 287
DpnII GATC 1 cut(s) 285
Eco130I CCWWGG 1 cut(s) 205
EcoT14I CCWWGG 1 cut(s) 205
ErhI CCWWGG 1 cut(s) 205
FaiI YATR 6 cut(s) 6, 44, 189, 280, 318, 364
FalI AAGNNNNNCTT 2 cut(s) 115, 147
FokI GGATG 2 cut(s) 46, 222
GsaI CCCAGC 1 cut(s) 33
HaeIII GGCC 1 cut(s) 144
HinfI GANTC 2 cut(s) 244, 355
HphI GGTGA 1 cut(s) 88
Hpy166II GTNNAC 1 cut(s) 96
Hpy188I TCNGA 3 cut(s) 182, 312, 346
Hpy188III TCNNGA 1 cut(s) 241
Hpy8I GTNNAC 1 cut(s) 96
HpyCH4III ACNGT 1 cut(s) 308
HpyCH4V TGCA 2 cut(s) 191, 272
HpyF3I CTNAG 1 cut(s) 311
Kzo9I GATC 1 cut(s) 285
LpnPI CCDG 2 cut(s) 15, 159
MalI GATC 1 cut(s) 287
MboI GATC 1 cut(s) 285
MboII GAAGA 1 cut(s) 345
MflI RGATCY 1 cut(s) 285
MhlI GDGCHC 2 cut(s) 238, 295
MluCI AATT 5 cut(s) 80, 106, 183, 267, 347
MmeI TCCRAC 1 cut(s) 100
MnlI CCTC 2 cut(s) 8, 146
MroXI GAANNNNTTC 1 cut(s) 340
NdeII GATC 1 cut(s) 285
PdmI GAANNNNTTC 1 cut(s) 340
PfeI GAWTC 2 cut(s) 244, 355
PspFI CCCAGC 1 cut(s) 29
PspPI GGNCC 1 cut(s) 143
PsuI RGATCY 1 cut(s) 285
RsaI GTAC 1 cut(s) 305
RsaNI GTAC 1 cut(s) 304
Sau3AI GATC 1 cut(s) 285
Sau96I GGNCC 1 cut(s) 143
SduI GDGCHC 2 cut(s) 238, 295
SetI ASST 6 cut(s) 19, 101, 133, 199, 207, 378
SgeI CNNG 7 cut(s) 42, 61, 158, 218, 239, 253, 342
Sse9I AATT 5 cut(s) 80, 106, 183, 267, 347
SsiI CCGC 1 cut(s) 116
StyI CCWWGG 1 cut(s) 205
TaaI ACNGT 1 cut(s) 308
TaqI TCGA 2 cut(s) 53, 331
TasI AATT 5 cut(s) 80, 106, 183, 267, 347
TfiI GAWTC 2 cut(s) 244, 355
XapI RAATTY 2 cut(s) 80, 183
XmnI GAANNNNTTC 1 cut(s) 340
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.