Rh1DG071900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
13051736 .. 13065954
14219 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG071900.1

Sequence Viewer

Length: 336 bp
ATGGTGGAGATGAAGCAGGAAGAAGAGAAGGAGGGAATGGCGATAATCAAAGGAAAAGAAGCTATCAGATTGAGAAGGGGATTTAAGTTGATTGAAGTTTCTTTCGCAGTCGGAAATGCCCCTCCTTCCATCAACCTATCCACCTTAATCTCCAGCCTACGCATAAAATACGAGTTTCCCTTCTTCCCAACGCTGATCAGAACCACCTCCAATCCAAATTTCCTCAACTCCACAATTCGGACTATATATATAAAGCTTTCGATTGAGAAAGCTTTAACGAAGTTTCTAGGTCGTGTTCGCCCCGACTTGGGCAGGAGCCGGACTAAGATTAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.73

Weight (kDa)

10.6

Isoelectric Point (pI)

44.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019314)

Species Orthologous Gene IDs
pyrus_communis pycom02g08650 pycom15g20200
rosa_laevigata RLG00000022348
rosa_rugosa Rorug05G0301000
rosa_samantha Rh1CG067100 Rh1DG071900 Rh5BG382600 Rh7BG084600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 217
AfiI CCNNNNNNNGG 3 cut(s) 237, 307, 308
AgsI TTSAA 1 cut(s) 95
AjuI GAANNNNNNNTTGG 2 cut(s) 203, 235
AluBI AGCT 3 cut(s) 62, 256, 272
AluI AGCT 3 cut(s) 62, 256, 272
ApoI RAATTY 1 cut(s) 217
BccI CCATC 1 cut(s) 137
BclI TGATCA 1 cut(s) 195
BfaI CTAG 1 cut(s) 287
BmiI GGNNCC 1 cut(s) 317
BpmI CTGGAG 1 cut(s) 136
Bsc4I CCNNNNNNNGG 3 cut(s) 237, 307, 308
BseLI CCNNNNNNNGG 3 cut(s) 237, 307, 308
BsiSI CCGG 1 cut(s) 319
BslI CCNNNNNNNGG 3 cut(s) 237, 307, 308
Bsp143I GATC 1 cut(s) 195
BspLI GGNNCC 1 cut(s) 317
BssMI GATC 1 cut(s) 195
Bst6I CTCTTC 1 cut(s) 18
BstDEI CTNAG 1 cut(s) 324
BstKTI GATC 1 cut(s) 198
BstMBI GATC 1 cut(s) 195
CviJI RGCY 5 cut(s) 62, 156, 256, 272, 318
CviKI_1 RGCY 5 cut(s) 62, 156, 256, 272, 318
DdeI CTNAG 1 cut(s) 324
DpnI GATC 1 cut(s) 197
DpnII GATC 1 cut(s) 195
Eam1104I CTCTTC 1 cut(s) 18
EarI CTCTTC 1 cut(s) 18
FaiI YATR 5 cut(s) 164, 245, 247, 249, 251
FbaI TGATCA 1 cut(s) 195
FspBI CTAG 1 cut(s) 287
GsuI CTGGAG 1 cut(s) 136
HapII CCGG 1 cut(s) 319
HindIII AAGCTT 2 cut(s) 254, 270
HpaII CCGG 1 cut(s) 319
Hpy188I TCNGA 4 cut(s) 68, 113, 200, 240
HpyAV CCTTC 4 cut(s) 22, 69, 135, 190
HpyF3I CTNAG 1 cut(s) 324
Ksp22I TGATCA 1 cut(s) 195
Kzo9I GATC 1 cut(s) 195
LmnI GCTCC 1 cut(s) 315
LpnPI CCDG 4 cut(s) 2, 166, 298, 332
MaeI CTAG 1 cut(s) 287
MalI GATC 1 cut(s) 197
MboI GATC 1 cut(s) 195
MboII GAAGA 3 cut(s) 32, 35, 175
MluCI AATT 2 cut(s) 217, 234
MmeI TCCRAC 1 cut(s) 91
MnlI CCTC 4 cut(s) 25, 132, 217, 233
MseI TTAA 3 cut(s) 84, 146, 275
MspI CCGG 1 cut(s) 319
NdeII GATC 1 cut(s) 195
NlaIV GGNNCC 1 cut(s) 317
PspN4I GGNNCC 1 cut(s) 317
SaqAI TTAA 3 cut(s) 84, 146, 275
Sau3AI GATC 1 cut(s) 195
SetI ASST 7 cut(s) 64, 138, 146, 209, 258, 274, 292
SgeI CNNG 9 cut(s) 29, 165, 184, 299, 305, 314, 319, 325, 331
Sse9I AATT 2 cut(s) 217, 234
SspMI CTAG 1 cut(s) 287
TaqI TCGA 1 cut(s) 260
TasI AATT 2 cut(s) 217, 234
Tru1I TTAA 3 cut(s) 84, 146, 275
Tru9I TTAA 3 cut(s) 84, 146, 275
TspDTI ATGAA 1 cut(s) 26
XapI RAATTY 1 cut(s) 217
XspI CTAG 1 cut(s) 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.