Rh1DG234800

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
44771074 .. 44771736
663 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG234800.1

Sequence Viewer

Length: 405 bp
ATGTTCACGGTGCATTTACATGAAGTGCCTGCACTTTATAAAAAAAATTATGTCAGTGAGAGAAGACACTTTTATAAAAGCACTGCCAAACAATCCCACTCATGCATGTCTGATGATGAATCAAAGCTTACATTATTGAATTGGATGTCAATAAATTGCAGAAGTGCACCATCATATGGGAACTCTGTAGTTGGGTGGGATGTGAGCTATGGAGCTGAATTTGTTCTTGTTCCTGACTCTATACTGATCATTCAAACAGCCACAAAGATGACTCCAACTGATGAACCATTAAAAGGGATTTCACAGTTTGTTGGAGCTTCAACAGGAACTTGGAATCTTAAAATCCCTGTTAAAGACGCACTAAGTGATGGTCATGGTCATAATTCTCCTCCTCCGAGAGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

134

Amino Acids

14.84

Weight (kDa)

7.82

Isoelectric Point (pI)

53.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 39, 75
AccB7I CCANNNNNTGG 1 cut(s) 176
AcsI RAATTY 1 cut(s) 218
AdeI CACNNNGTG 1 cut(s) 365
AfiI CCNNNNNNNGG 2 cut(s) 176, 293
AgsI TTSAA 3 cut(s) 139, 254, 321
AluBI AGCT 5 cut(s) 127, 207, 215, 317, 401
AluI AGCT 5 cut(s) 127, 207, 215, 317, 401
Alw21I GWGCWC 1 cut(s) 169
Alw44I GTGCAC 1 cut(s) 165
ApaLI GTGCAC 1 cut(s) 165
ApoI RAATTY 1 cut(s) 218
Asp700I GAANNNNTTC 1 cut(s) 222
BaeGI GKGCMC 1 cut(s) 169
BbsI GAAGAC 1 cut(s) 70
Bbv12I GWGCWC 1 cut(s) 169
BccI CCATC 2 cut(s) 178, 362
BclI TGATCA 1 cut(s) 246
BfmI CTRYAG 1 cut(s) 186
BpiI GAAGAC 1 cut(s) 70
Bsc4I CCNNNNNNNGG 2 cut(s) 176, 293
BseGI GGATG 2 cut(s) 150, 205
BseLI CCNNNNNNNGG 2 cut(s) 176, 293
BseRI GAGGAG 2 cut(s) 378, 381
BseSI GKGCMC 1 cut(s) 169
BsgI GTGCAG 1 cut(s) 15
BsiHKAI GWGCWC 1 cut(s) 169
BslI CCNNNNNNNGG 2 cut(s) 176, 293
Bsp1286I GDGCHC 1 cut(s) 169
Bsp143I GATC 1 cut(s) 246
BssMI GATC 1 cut(s) 246
Bst4CI ACNGT 2 cut(s) 10, 306
BstC8I GCNNGC 1 cut(s) 30
BstDEI CTNAG 1 cut(s) 362
BstF5I GGATG 2 cut(s) 150, 205
BstKTI GATC 1 cut(s) 249
BstMBI GATC 1 cut(s) 246
BstNSI RCATGY 1 cut(s) 109
BstSFI CTRYAG 1 cut(s) 186
BstSLI GKGCMC 1 cut(s) 169
BstV2I GAAGAC 1 cut(s) 70
BtsCI GGATG 2 cut(s) 150, 205
BtsI GCAGTG 1 cut(s) 81
BtsIMutI CAGTG 2 cut(s) 61, 81
Cac8I GCNNGC 1 cut(s) 30
CseI GACGC 1 cut(s) 365
CviAII CATG 4 cut(s) 20, 102, 106, 374
CviJI RGCY 6 cut(s) 127, 207, 215, 260, 317, 401
CviKI_1 RGCY 6 cut(s) 127, 207, 215, 260, 317, 401
DdeI CTNAG 1 cut(s) 362
DpnI GATC 1 cut(s) 248
DpnII GATC 1 cut(s) 246
DraIII CACNNNGTG 1 cut(s) 365
EcoT22I ATGCAT 1 cut(s) 107
FaeI CATG 4 cut(s) 23, 105, 109, 377
FatI CATG 4 cut(s) 19, 101, 105, 373
FauNDI CATATG 1 cut(s) 175
FbaI TGATCA 1 cut(s) 246
FokI GGATG 2 cut(s) 157, 212
HgaI GACGC 1 cut(s) 365
Hin1II CATG 4 cut(s) 23, 105, 109, 377
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 4 cut(s) 119, 236, 271, 334
Hpy166II GTNNAC 2 cut(s) 6, 167
Hpy188I TCNGA 2 cut(s) 112, 396
Hpy188III TCNNGA 1 cut(s) 233
Hpy8I GTNNAC 2 cut(s) 6, 167
HpyCH4III ACNGT 2 cut(s) 10, 306
HpyCH4V TGCA 5 cut(s) 13, 32, 105, 159, 167
HpyF3I CTNAG 1 cut(s) 362
Hsp92II CATG 4 cut(s) 23, 105, 109, 377
Ksp22I TGATCA 1 cut(s) 246
Kzo9I GATC 1 cut(s) 246
LmnI GCTCC 2 cut(s) 212, 314
LpnPI CCDG 4 cut(s) 42, 246, 309, 360
MalI GATC 1 cut(s) 248
MboI GATC 1 cut(s) 246
MboII GAAGA 1 cut(s) 75
MhlI GDGCHC 1 cut(s) 169
MluCI AATT 5 cut(s) 46, 139, 154, 218, 382
MlyI GAGTC 2 cut(s) 230, 265
MmeI TCCRAC 2 cut(s) 292, 299
MnlI CCTC 2 cut(s) 399, 402
Mph1103I ATGCAT 1 cut(s) 107
MroXI GAANNNNTTC 1 cut(s) 222
MseI TTAA 4 cut(s) 290, 339, 351, 403
MslI CAYNNNNRTG 2 cut(s) 18, 266
NdeI CATATG 1 cut(s) 175
NdeII GATC 1 cut(s) 246
NlaIII CATG 4 cut(s) 23, 105, 109, 377
NsiI ATGCAT 1 cut(s) 107
NspI RCATGY 1 cut(s) 109
PdmI GAANNNNTTC 1 cut(s) 222
PfeI GAWTC 2 cut(s) 119, 334
PflMI CCANNNNNTGG 1 cut(s) 176
PleI GAGTC 2 cut(s) 230, 265
PpsI GAGTC 2 cut(s) 230, 265
PsiI TTATAA 2 cut(s) 39, 75
RseI CAYNNNNRTG 2 cut(s) 18, 266
SaqAI TTAA 4 cut(s) 290, 339, 351, 403
Sau3AI GATC 1 cut(s) 246
SchI GAGTC 2 cut(s) 230, 265
SduI GDGCHC 1 cut(s) 169
SetI ASST 5 cut(s) 129, 209, 217, 319, 403
SfcI CTRYAG 1 cut(s) 186
SmiMI CAYNNNNRTG 2 cut(s) 18, 266
Sse9I AATT 5 cut(s) 46, 139, 154, 218, 382
TaaI ACNGT 2 cut(s) 10, 306
TasI AATT 5 cut(s) 46, 139, 154, 218, 382
TfiI GAWTC 2 cut(s) 119, 334
Tru1I TTAA 4 cut(s) 290, 339, 351, 403
Tru9I TTAA 4 cut(s) 290, 339, 351, 403
TscAI CASTG 2 cut(s) 61, 88
TspDTI ATGAA 3 cut(s) 36, 132, 297
TspRI CASTG 2 cut(s) 61, 88
Van91I CCANNNNNTGG 1 cut(s) 176
VneI GTGCAC 1 cut(s) 165
XapI RAATTY 1 cut(s) 218
XceI RCATGY 1 cut(s) 109
XmnI GAANNNNTTC 1 cut(s) 222
Zsp2I ATGCAT 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.