Rh6CG087100

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
9498096 .. 9498332
237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG087100.1

Sequence Viewer

Length: 237 bp
ATGAAGGACCTTTCTCCAGTCATGTTCGAGGATGTGAGCTATGGAGCTGAATTTGTTCATGTTCCTGACTCTATACTGATCATTCAAACAGCCACAAAGATGAATCCAATTGATGAACCATTAAAAGGGATTTCACAGTTTGTTGGAGCTTCAACAGGAACTTGGAATCTTAAAATCCCTGTTAAAGACGCACTAAGTGATGGTCATGGTCATAATTCTCCTCCTCCGAGAACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.45

Weight (kDa)

5.37

Isoelectric Point (pI)

35.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 50
AdeI CACNNNGTG 1 cut(s) 197
AfiI CCNNNNNNNGG 1 cut(s) 125
AgsI TTSAA 2 cut(s) 86, 153
AluBI AGCT 3 cut(s) 39, 47, 149
AluI AGCT 3 cut(s) 39, 47, 149
ApoI RAATTY 1 cut(s) 50
Asp700I GAANNNNTTC 1 cut(s) 54
AspS9I GGNCC 1 cut(s) 7
AvaII GGWCC 1 cut(s) 7
BccI CCATC 1 cut(s) 194
BclI TGATCA 1 cut(s) 78
Bme18I GGWCC 1 cut(s) 7
BmgT120I GGNCC 1 cut(s) 7
Bsc4I CCNNNNNNNGG 1 cut(s) 125
Bse1I ACTGG 1 cut(s) 17
BseGI GGATG 1 cut(s) 37
BseLI CCNNNNNNNGG 1 cut(s) 125
BseNI ACTGG 1 cut(s) 17
BseRI GAGGAG 2 cut(s) 210, 213
BslI CCNNNNNNNGG 1 cut(s) 125
Bsp143I GATC 1 cut(s) 78
BsrI ACTGG 1 cut(s) 17
BssMI GATC 1 cut(s) 78
Bst4CI ACNGT 1 cut(s) 138
BstDEI CTNAG 1 cut(s) 194
BstF5I GGATG 1 cut(s) 37
BstKTI GATC 1 cut(s) 81
BstMBI GATC 1 cut(s) 78
BtsCI GGATG 1 cut(s) 37
Cfr13I GGNCC 1 cut(s) 7
CseI GACGC 1 cut(s) 197
CviAII CATG 3 cut(s) 22, 59, 206
CviJI RGCY 4 cut(s) 39, 47, 92, 149
CviKI_1 RGCY 4 cut(s) 39, 47, 92, 149
DdeI CTNAG 1 cut(s) 194
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
DraIII CACNNNGTG 1 cut(s) 197
Eco47I GGWCC 1 cut(s) 7
EcoO109I RGGNCCY 1 cut(s) 7
FaeI CATG 3 cut(s) 25, 62, 209
FaiI YATR 6 cut(s) 23, 42, 60, 74, 207, 213
FatI CATG 3 cut(s) 21, 58, 205
FbaI TGATCA 1 cut(s) 78
FokI GGATG 1 cut(s) 44
HgaI GACGC 1 cut(s) 197
Hin1II CATG 3 cut(s) 25, 62, 209
HinfI GANTC 3 cut(s) 68, 103, 166
Hpy188I TCNGA 1 cut(s) 228
Hpy188III TCNNGA 1 cut(s) 65
HpyCH4III ACNGT 1 cut(s) 138
HpyF3I CTNAG 1 cut(s) 194
Hsp92II CATG 3 cut(s) 25, 62, 209
Ksp22I TGATCA 1 cut(s) 78
Kzo9I GATC 1 cut(s) 78
LmnI GCTCC 2 cut(s) 44, 146
LpnPI CCDG 4 cut(s) 30, 78, 141, 192
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MfeI CAATTG 1 cut(s) 108
MluCI AATT 3 cut(s) 50, 108, 214
MlyI GAGTC 1 cut(s) 62
MmeI TCCRAC 1 cut(s) 124
MnlI CCTC 3 cut(s) 22, 231, 234
MroXI GAANNNNTTC 1 cut(s) 54
MseI TTAA 4 cut(s) 122, 171, 183, 235
MslI CAYNNNNRTG 1 cut(s) 98
MunI CAATTG 1 cut(s) 108
NdeII GATC 1 cut(s) 78
NlaIII CATG 3 cut(s) 25, 62, 209
PdmI GAANNNNTTC 1 cut(s) 54
PfeI GAWTC 2 cut(s) 103, 166
PleI GAGTC 1 cut(s) 62
PpsI GAGTC 1 cut(s) 62
PpuMI RGGWCCY 1 cut(s) 7
Psp5II RGGWCCY 1 cut(s) 7
PspPI GGNCC 1 cut(s) 7
PspPPI RGGWCCY 1 cut(s) 7
RseI CAYNNNNRTG 1 cut(s) 98
SaqAI TTAA 4 cut(s) 122, 171, 183, 235
Sau3AI GATC 1 cut(s) 78
Sau96I GGNCC 1 cut(s) 7
SchI GAGTC 1 cut(s) 62
SetI ASST 4 cut(s) 12, 41, 49, 151
SgeI CNNG 9 cut(s) 29, 34, 40, 71, 77, 168, 174, 191, 218
SinI GGWCC 1 cut(s) 7
SmiMI CAYNNNNRTG 1 cut(s) 98
Sse9I AATT 3 cut(s) 50, 108, 214
TaaI ACNGT 1 cut(s) 138
TaqI TCGA 1 cut(s) 27
TasI AATT 3 cut(s) 50, 108, 214
TfiI GAWTC 2 cut(s) 103, 166
Tru1I TTAA 4 cut(s) 122, 171, 183, 235
Tru9I TTAA 4 cut(s) 122, 171, 183, 235
TspDTI ATGAA 4 cut(s) 17, 47, 116, 129
VpaK11BI GGWCC 1 cut(s) 7
XapI RAATTY 1 cut(s) 50
XmnI GAANNNNTTC 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.