Rh6DG222500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
39726746 .. 39740352
13607 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG222500.1

Sequence Viewer

Length: 516 bp
ATGAAGGACCTTTCTCCAGTCATGTTCGAGGATGTGAGCTATGGAGCTGAATTTGTTCATGTTCCTGACTCTATACTGATCATTCAAACAGCCAAAAAGATGACTCCAACTGATGAACCATTAAAAGGGATTTCACAGTTTGTTGGAGGTTCAACAGGAACTTGGATTCTTAAAATCCCTATCGAGGTTGCCTCTAGCTCCAAGCTTCATCCCTCATCCTTTTCTCTCAGATCTTCCACAGCCTCTTCCTCTTGTCTCAGATCGAGGTTGCCTCCAGCTCCAAGCTCCATCCCTCATCCTCTTCTCTCAGATCGACCACAGCCTCTTCCACATCCGATCAATTTCGTCTCTGATTTCGGGTTCTACCCGTCTAAGCTTAGTTGCATTTCCAAAGTAGTAATCTTGAAGCCGGAGCTTCATCTATCTCAGCATCTTCTAAGAAAACTAGATTCACTAGTAATGTTTGGGAGTTTTTTGAAAGGGTTCAAGTTAATGAGCATGGAAGTATGCACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

171

Amino Acids

18.77

Weight (kDa)

9.05

Isoelectric Point (pI)

58.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 50
AfiI CCNNNNNNNGG 2 cut(s) 125, 184
AgsI TTSAA 5 cut(s) 86, 153, 406, 478, 487
AhlI ACTAGT 1 cut(s) 454
AluBI AGCT 8 cut(s) 39, 47, 198, 205, 278, 285, 376, 415
AluI AGCT 8 cut(s) 39, 47, 198, 205, 278, 285, 376, 415
Alw26I GTCTC 2 cut(s) 260, 352
ApoI RAATTY 1 cut(s) 50
Asp700I GAANNNNTTC 2 cut(s) 54, 482
AspS9I GGNCC 1 cut(s) 7
AvaII GGWCC 1 cut(s) 7
BccI CCATC 1 cut(s) 296
BclI TGATCA 1 cut(s) 78
BcoDI GTCTC 2 cut(s) 260, 352
BcuI ACTAGT 1 cut(s) 454
BfaI CTAG 4 cut(s) 195, 446, 455, 514
BglII AGATCT 1 cut(s) 230
Bme18I GGWCC 1 cut(s) 7
BmgT120I GGNCC 1 cut(s) 7
BmsI GCATC 1 cut(s) 439
BplI GAGNNNNNCTC 4 cut(s) 176, 208, 256, 288
BpmI CTGGAG 1 cut(s) 258
Bsc4I CCNNNNNNNGG 2 cut(s) 125, 184
Bse1I ACTGG 1 cut(s) 17
BseGI GGATG 6 cut(s) 37, 208, 215, 288, 295, 331
BseLI CCNNNNNNNGG 2 cut(s) 125, 184
BseMII CTCAG 4 cut(s) 241, 271, 321, 440
BseNI ACTGG 1 cut(s) 17
BsiSI CCGG 1 cut(s) 410
BslI CCNNNNNNNGG 2 cut(s) 125, 184
BsmAI GTCTC 2 cut(s) 260, 352
BsmBI CGTCTC 1 cut(s) 352
Bsp143I GATC 5 cut(s) 78, 230, 260, 310, 336
BspCNI CTCAG 4 cut(s) 240, 270, 320, 439
BsrI ACTGG 1 cut(s) 17
BssMI GATC 5 cut(s) 78, 230, 260, 310, 336
Bst4CI ACNGT 1 cut(s) 138
Bst6I CTCTTC 3 cut(s) 250, 306, 330
BstDEI CTNAG 7 cut(s) 227, 257, 307, 372, 377, 426, 437
BstF5I GGATG 6 cut(s) 37, 208, 215, 288, 295, 331
BstKTI GATC 5 cut(s) 81, 233, 263, 313, 339
BstMAI GTCTC 2 cut(s) 260, 352
BstMBI GATC 5 cut(s) 78, 230, 260, 310, 336
BstX2I RGATCY 1 cut(s) 230
BstYI RGATCY 1 cut(s) 230
BtsCI GGATG 6 cut(s) 37, 208, 215, 288, 295, 331
Cfr13I GGNCC 1 cut(s) 7
CviAII CATG 3 cut(s) 22, 59, 499
DdeI CTNAG 7 cut(s) 227, 257, 307, 372, 377, 426, 437
DpnI GATC 5 cut(s) 80, 232, 262, 312, 338
DpnII GATC 5 cut(s) 78, 230, 260, 310, 336
Eam1104I CTCTTC 3 cut(s) 250, 306, 330
EarI CTCTTC 3 cut(s) 250, 306, 330
Eco47I GGWCC 1 cut(s) 7
EcoO109I RGGNCCY 1 cut(s) 7
Esp3I CGTCTC 1 cut(s) 352
FaeI CATG 3 cut(s) 25, 62, 502
FaiI YATR 6 cut(s) 23, 42, 60, 74, 500, 508
FatI CATG 3 cut(s) 21, 58, 498
FbaI TGATCA 1 cut(s) 78
FokI GGATG 6 cut(s) 44, 195, 202, 275, 282, 318
FspBI CTAG 4 cut(s) 195, 446, 455, 514
GsuI CTGGAG 1 cut(s) 258
HapII CCGG 1 cut(s) 410
Hin1II CATG 3 cut(s) 25, 62, 502
HindIII AAGCTT 2 cut(s) 203, 374
HinfI GANTC 4 cut(s) 68, 103, 166, 449
HpaII CCGG 1 cut(s) 410
Hpy188I TCNGA 5 cut(s) 230, 260, 310, 336, 352
Hpy188III TCNNGA 2 cut(s) 65, 403
HpyCH4III ACNGT 1 cut(s) 138
HpyCH4V TGCA 2 cut(s) 384, 510
HpyF3I CTNAG 7 cut(s) 227, 257, 307, 372, 377, 426, 437
Hsp92II CATG 3 cut(s) 25, 62, 502
Ksp22I TGATCA 1 cut(s) 78
Kzo9I GATC 5 cut(s) 78, 230, 260, 310, 336
LmnI GCTCC 5 cut(s) 44, 203, 283, 290, 412
LpnPI CCDG 5 cut(s) 30, 78, 141, 288, 423
LweI GCATC 1 cut(s) 439
MaeI CTAG 4 cut(s) 195, 446, 455, 514
MalI GATC 5 cut(s) 80, 232, 262, 312, 338
MboI GATC 5 cut(s) 78, 230, 260, 310, 336
MboII GAAGA 5 cut(s) 225, 237, 293, 317, 425
MflI RGATCY 1 cut(s) 230
MluCI AATT 2 cut(s) 50, 340
MlyI GAGTC 2 cut(s) 62, 97
MmeI TCCRAC 2 cut(s) 124, 131
MroXI GAANNNNTTC 2 cut(s) 54, 482
MseI TTAA 3 cut(s) 122, 171, 491
MspI CCGG 1 cut(s) 410
NdeII GATC 5 cut(s) 78, 230, 260, 310, 336
NlaIII CATG 3 cut(s) 25, 62, 502
PdmI GAANNNNTTC 2 cut(s) 54, 482
PfeI GAWTC 2 cut(s) 166, 449
PleI GAGTC 2 cut(s) 62, 97
PpsI GAGTC 2 cut(s) 62, 97
PpuMI RGGWCCY 1 cut(s) 7
Psp5II RGGWCCY 1 cut(s) 7
PspPI GGNCC 1 cut(s) 7
PspPPI RGGWCCY 1 cut(s) 7
PsuI RGATCY 1 cut(s) 230
SaqAI TTAA 3 cut(s) 122, 171, 491
Sau3AI GATC 5 cut(s) 78, 230, 260, 310, 336
Sau96I GGNCC 1 cut(s) 7
SchI GAGTC 2 cut(s) 62, 97
SfaNI GCATC 1 cut(s) 439
SinI GGWCC 1 cut(s) 7
SpeI ACTAGT 1 cut(s) 454
Sse9I AATT 2 cut(s) 50, 340
SspMI CTAG 4 cut(s) 195, 446, 455, 514
TaaI ACNGT 1 cut(s) 138
TaqI TCGA 4 cut(s) 27, 183, 263, 313
TasI AATT 2 cut(s) 50, 340
TfiI GAWTC 2 cut(s) 166, 449
Tru1I TTAA 3 cut(s) 122, 171, 491
Tru9I TTAA 3 cut(s) 122, 171, 491
TspDTI ATGAA 5 cut(s) 17, 47, 129, 197, 407
VpaK11BI GGWCC 1 cut(s) 7
XapI RAATTY 1 cut(s) 50
XmnI GAANNNNTTC 2 cut(s) 54, 482
XspI CTAG 4 cut(s) 195, 446, 455, 514
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.