Rh2AG114300

acyl-activating enzyme

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
10191295 .. 10191558
264 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG114300.1

Sequence Viewer

Length: 264 bp
ATGGAAAGTGTACCGCCTGATGGTAAGACAATGGGTGAAATTATGTTCAGGGGAAACACTGTGATGAGTGGTTATCTTAAAGACTTGAAAGCAACAGAGGAAGCTTTTAAGGGTGGATGGTTTAGAAGTGGGGATTTAGCTGTGAAACATCCTGATAACTATATAGAAGTCAAGGACCGGTTGAAGGATGTGATTATATCTGGGGGAGAGAACATAAGCACAGTTGAGGTTGAAACGGCTAAACAACCATCCAGCAGTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.51

Weight (kDa)

5.07

Isoelectric Point (pI)

47.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 14
AfaI GTAC 1 cut(s) 12
AfiI CCNNNNNNNGG 2 cut(s) 20, 184
AgeI ACCGGT 1 cut(s) 177
AgsI TTSAA 3 cut(s) 88, 184, 233
AluBI AGCT 2 cut(s) 104, 140
AluI AGCT 2 cut(s) 104, 140
AsiGI ACCGGT 1 cut(s) 177
AspS9I GGNCC 1 cut(s) 175
AsuHPI GGTGA 1 cut(s) 47
AvaII GGWCC 1 cut(s) 175
BccI CCATC 3 cut(s) 14, 111, 256
BceAI ACGGC 1 cut(s) 252
Bme18I GGWCC 1 cut(s) 175
BmgT120I GGNCC 1 cut(s) 175
BsaWI WCCGGW 1 cut(s) 177
Bsc4I CCNNNNNNNGG 2 cut(s) 20, 184
Bse118I RCCGGY 1 cut(s) 177
BseGI GGATG 4 cut(s) 122, 148, 193, 248
BseLI CCNNNNNNNGG 2 cut(s) 20, 184
BshTI ACCGGT 1 cut(s) 177
BsiSI CCGG 1 cut(s) 178
BslI CCNNNNNNNGG 2 cut(s) 20, 184
BspACI CCGC 1 cut(s) 14
BsrFI RCCGGY 1 cut(s) 177
BssAI RCCGGY 1 cut(s) 177
Bst4CI ACNGT 2 cut(s) 61, 223
BstF5I GGATG 4 cut(s) 122, 148, 193, 248
BtsCI GGATG 4 cut(s) 122, 148, 193, 248
BtsIMutI CAGTG 1 cut(s) 57
Cfr10I RCCGGY 1 cut(s) 177
Cfr13I GGNCC 1 cut(s) 175
Csp6I GTAC 1 cut(s) 11
CspAI ACCGGT 1 cut(s) 177
CviJI RGCY 3 cut(s) 104, 140, 239
CviKI_1 RGCY 3 cut(s) 104, 140, 239
CviQI GTAC 1 cut(s) 11
Eco47I GGWCC 1 cut(s) 175
FaiI YATR 5 cut(s) 44, 162, 164, 197, 215
FokI GGATG 4 cut(s) 129, 135, 200, 235
HapII CCGG 1 cut(s) 178
HindIII AAGCTT 1 cut(s) 102
HpaII CCGG 1 cut(s) 178
HphI GGTGA 1 cut(s) 47
Hpy166II GTNNAC 1 cut(s) 11
Hpy188III TCNNGA 2 cut(s) 152, 261
Hpy8I GTNNAC 1 cut(s) 11
HpyAV CCTTC 1 cut(s) 178
HpyCH4III ACNGT 2 cut(s) 61, 223
LpnPI CCDG 5 cut(s) 30, 34, 165, 186, 191
MluCI AATT 1 cut(s) 39
MnlI CCTC 2 cut(s) 91, 220
MseI TTAA 2 cut(s) 78, 108
MslI CAYNNNNRTG 1 cut(s) 62
MspI CCGG 1 cut(s) 178
PinAI ACCGGT 1 cut(s) 177
PspPI GGNCC 1 cut(s) 175
RsaI GTAC 1 cut(s) 12
RsaNI GTAC 1 cut(s) 11
RseI CAYNNNNRTG 1 cut(s) 62
SaqAI TTAA 2 cut(s) 78, 108
Sau96I GGNCC 1 cut(s) 175
SetI ASST 3 cut(s) 106, 142, 231
SgeI CNNG 7 cut(s) 29, 61, 97, 164, 184, 190, 213
SinI GGWCC 1 cut(s) 175
SmiMI CAYNNNNRTG 1 cut(s) 62
Sse9I AATT 1 cut(s) 39
SsiI CCGC 1 cut(s) 14
TaaI ACNGT 2 cut(s) 61, 223
TasI AATT 1 cut(s) 39
Tru1I TTAA 2 cut(s) 78, 108
Tru9I TTAA 2 cut(s) 78, 108
TscAI CASTG 1 cut(s) 64
TspRI CASTG 1 cut(s) 64
VpaK11BI GGWCC 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.