Rh2BG203200

Cyclic nucleotide-gated ion channel 1-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
18802073 .. 18802393
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG203200.1

Sequence Viewer

Length: 321 bp
ATGTGTGATAGTCTCAAGCCAGTAATCTATACAGAGGAAAGCTACATTTTTCAAGAGAGTGGAACTGTGGATGCAATGCTCTTCATAGCACAAGGAAGGTTAATGAGACTGACAAGTTACGGTGCAACAACTGAGGCATTCTTGTACATATATCTCGGCTATGGTGACTTCTGTGGTGAAGAGCTTATCGGATGGGCGTTTGATCCCCACTCGTCATCTATTAAACTTCCCTCATCCATTGCAACTGTCCAGTCTCTAAGTAAAGTTCTGGCACTTGTTTTAAAAGCAGATGACTTGAAGCTCATAGCCTCCCAGTTCTAG

Protein Analysis

106

Amino Acids

11.7

Weight (kDa)

4.57

Isoelectric Point (pI)

30.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018352)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g17020
rosa_chinensis RchiOBHm_Chr2g0107171 RchiOBHm_Chr2g0107181
rosa_laevigata RLG00000017557
rosa_multiflora Rmu_sc0002945.1_g000016
rosa_roxburghii Rroxscaffold_2G00136570
rosa_rugosa Rorug02G0140500
rosa_samantha Rh2BG203200 Rh2DG198600
rosa_wichuraiana Rw2G015120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 197
AfaI GTAC 1 cut(s) 146
AgsI TTSAA 2 cut(s) 53, 298
AluBI AGCT 3 cut(s) 42, 184, 301
AluI AGCT 3 cut(s) 42, 184, 301
Alw26I GTCTC 3 cut(s) 17, 100, 258
AlwI GGATC 1 cut(s) 197
AsuHPI GGTGA 2 cut(s) 176, 188
BccI CCATC 1 cut(s) 186
BcoDI GTCTC 3 cut(s) 17, 100, 258
BfaI CTAG 1 cut(s) 319
BmrI ACTGGG 1 cut(s) 307
BmsI GCATC 1 cut(s) 61
BmuI ACTGGG 1 cut(s) 307
Bse1I ACTGG 3 cut(s) 20, 250, 313
Bse3DI GCAATG 2 cut(s) 81, 237
BseGI GGATG 3 cut(s) 76, 197, 233
BseMI GCAATG 2 cut(s) 81, 237
BseMII CTCAG 1 cut(s) 123
BseNI ACTGG 3 cut(s) 20, 250, 313
BsmAI GTCTC 3 cut(s) 17, 100, 258
BsmI GAATGC 1 cut(s) 137
Bsp1407I TGTACA 1 cut(s) 144
Bsp143I GATC 1 cut(s) 202
BspCNI CTCAG 1 cut(s) 124
BspPI GGATC 1 cut(s) 197
BspQI GCTCTTC 2 cut(s) 86, 174
BsrDI GCAATG 2 cut(s) 81, 237
BsrGI TGTACA 1 cut(s) 144
BsrI ACTGG 3 cut(s) 20, 250, 313
BssMI GATC 1 cut(s) 202
Bst4CI ACNGT 3 cut(s) 67, 122, 247
Bst6I CTCTTC 2 cut(s) 86, 174
BstAUI TGTACA 1 cut(s) 144
BstDEI CTNAG 2 cut(s) 132, 257
BstF5I GGATG 3 cut(s) 76, 197, 233
BstKTI GATC 1 cut(s) 205
BstMAI GTCTC 3 cut(s) 17, 100, 258
BstMBI GATC 1 cut(s) 202
BtsCI GGATG 3 cut(s) 76, 197, 233
Csp6I GTAC 1 cut(s) 145
CviJI RGCY 6 cut(s) 19, 42, 159, 184, 301, 308
CviKI_1 RGCY 6 cut(s) 19, 42, 159, 184, 301, 308
CviQI GTAC 1 cut(s) 145
DdeI CTNAG 2 cut(s) 132, 257
DpnI GATC 1 cut(s) 204
DpnII GATC 1 cut(s) 202
DraI TTTAAA 1 cut(s) 282
Eam1104I CTCTTC 2 cut(s) 86, 174
EarI CTCTTC 2 cut(s) 86, 174
FaiI YATR 6 cut(s) 30, 86, 149, 151, 162, 305
FokI GGATG 3 cut(s) 83, 204, 220
FspBI CTAG 1 cut(s) 319
HphI GGTGA 2 cut(s) 176, 188
Hpy188I TCNGA 1 cut(s) 191
Hpy188III TCNNGA 1 cut(s) 53
HpyAV CCTTC 1 cut(s) 90
HpyCH4III ACNGT 3 cut(s) 67, 122, 247
HpyCH4V TGCA 3 cut(s) 74, 125, 242
HpyF3I CTNAG 2 cut(s) 132, 257
Kzo9I GATC 1 cut(s) 202
LguI GCTCTTC 2 cut(s) 86, 174
LpnPI CCDG 3 cut(s) 33, 254, 263
LweI GCATC 1 cut(s) 61
MaeI CTAG 1 cut(s) 319
MaeIII GTNAC 2 cut(s) 116, 164
MalI GATC 1 cut(s) 204
MboI GATC 1 cut(s) 202
MboII GAAGA 2 cut(s) 73, 191
MnlI CCTC 4 cut(s) 28, 127, 241, 319
MseI TTAA 3 cut(s) 101, 222, 281
Mva1269I GAATGC 1 cut(s) 137
NdeII GATC 1 cut(s) 202
NmeAIII GCCGAG 1 cut(s) 135
NmuCI GTSAC 1 cut(s) 164
PciSI GCTCTTC 2 cut(s) 86, 174
PctI GAATGC 1 cut(s) 137
RsaI GTAC 1 cut(s) 146
RsaNI GTAC 1 cut(s) 145
SapI GCTCTTC 2 cut(s) 86, 174
SaqAI TTAA 3 cut(s) 101, 222, 281
Sau3AI GATC 1 cut(s) 202
SetI ASST 4 cut(s) 44, 101, 186, 303
SfaNI GCATC 1 cut(s) 61
SmlI CTYRAG 1 cut(s) 14
SmoI CTYRAG 1 cut(s) 14
SspMI CTAG 1 cut(s) 319
TaaI ACNGT 3 cut(s) 67, 122, 247
TatI WGTACW 1 cut(s) 144
Tru1I TTAA 3 cut(s) 101, 222, 281
Tru9I TTAA 3 cut(s) 101, 222, 281
TseFI GTSAC 1 cut(s) 164
Tsp45I GTSAC 1 cut(s) 164
TspDTI ATGAA 1 cut(s) 73
XspI CTAG 1 cut(s) 319
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.