Rh2BG479000

Belongs to the terpene cyclase mutase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
67559825 .. 67574899
15075 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG479000.1

Sequence Viewer

Length: 219 bp
ATGGCAATCTATACACCTCTTGAAGGCGAACGGTCGAATTTGGTGCAGACTGCAATGGGACTAATGGGATTAATTCATGGTGGACAGAAAATTGTTGCACTGCTACCATCAAAAGAAACAGATCGAAGAAGCTACATGGCTGGTCCCAAGGCTCCACCGCTCCACCATCTTAATAAGGGGACACGAGTTCATCCAAGAAAGGAGAAAGGATACAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

7.98

Weight (kDa)

10.16

Isoelectric Point (pI)

43.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019328)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 160
AciI CCGC 1 cut(s) 158
AcsI RAATTY 1 cut(s) 37
AfiI CCNNNNNNNGG 1 cut(s) 23
AgsI TTSAA 1 cut(s) 23
AluBI AGCT 1 cut(s) 132
AluI AGCT 1 cut(s) 132
ApoI RAATTY 1 cut(s) 37
AseI ATTAAT 1 cut(s) 71
AspS9I GGNCC 1 cut(s) 143
AvaII GGWCC 1 cut(s) 143
BauI CACGAG 1 cut(s) 183
BccI CCATC 2 cut(s) 115, 174
BcgI CGANNNNNNTGC 2 cut(s) 25, 59
BciVI GTATCC 1 cut(s) 203
BfuI GTATCC 1 cut(s) 203
Bme18I GGWCC 1 cut(s) 143
BmgT120I GGNCC 1 cut(s) 143
BmiI GGNNCC 2 cut(s) 145, 153
BsaJI CCNNGG 1 cut(s) 147
Bsc4I CCNNNNNNNGG 1 cut(s) 23
Bse3DI GCAATG 1 cut(s) 60
BseDI CCNNGG 1 cut(s) 147
BseGI GGATG 1 cut(s) 190
BseLI CCNNNNNNNGG 1 cut(s) 23
BseMI GCAATG 1 cut(s) 60
BsgI GTGCAG 1 cut(s) 65
Bsh1285I CGRYCG 1 cut(s) 35
BsiEI CGRYCG 1 cut(s) 35
BslFI GGGAC 3 cut(s) 72, 129, 193
BslI CCNNNNNNNGG 1 cut(s) 23
BsmFI GGGAC 3 cut(s) 72, 129, 193
Bsp143I GATC 1 cut(s) 121
BspACI CCGC 1 cut(s) 158
BspLI GGNNCC 2 cut(s) 145, 153
BsrBI CCGCTC 1 cut(s) 160
BsrDI GCAATG 1 cut(s) 60
BssECI CCNNGG 1 cut(s) 147
BssMI GATC 1 cut(s) 121
BssSI CACGAG 1 cut(s) 183
BssT1I CCWWGG 1 cut(s) 147
Bst2BI CACGAG 1 cut(s) 183
Bst4CI ACNGT 1 cut(s) 33
BstENI CCTNNNNNAGG 1 cut(s) 21
BstF5I GGATG 1 cut(s) 190
BstKTI GATC 1 cut(s) 124
BstMBI GATC 1 cut(s) 121
BstMCI CGRYCG 1 cut(s) 35
BsuI GTATCC 1 cut(s) 203
BtsCI GGATG 1 cut(s) 190
BtsI GCAGTG 1 cut(s) 98
BtsIMutI CAGTG 1 cut(s) 98
Cfr13I GGNCC 1 cut(s) 143
CviAII CATG 2 cut(s) 77, 136
CviJI RGCY 3 cut(s) 132, 140, 152
CviKI_1 RGCY 3 cut(s) 132, 140, 152
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
Eco130I CCWWGG 1 cut(s) 147
Eco47I GGWCC 1 cut(s) 143
EcoNI CCTNNNNNAGG 1 cut(s) 21
EcoT14I CCWWGG 1 cut(s) 147
ErhI CCWWGG 1 cut(s) 147
FaeI CATG 2 cut(s) 80, 139
FaiI YATR 3 cut(s) 12, 78, 137
FaqI GGGAC 3 cut(s) 72, 129, 193
FatI CATG 2 cut(s) 76, 135
FokI GGATG 1 cut(s) 177
Hin1II CATG 2 cut(s) 80, 139
Hpy166II GTNNAC 1 cut(s) 83
Hpy188III TCNNGA 1 cut(s) 20
Hpy8I GTNNAC 1 cut(s) 83
HpyAV CCTTC 1 cut(s) 17
HpyCH4III ACNGT 1 cut(s) 33
HpyCH4V TGCA 3 cut(s) 46, 53, 98
Hsp92II CATG 2 cut(s) 80, 139
Kzo9I GATC 1 cut(s) 121
LmnI GCTCC 2 cut(s) 157, 165
LpnPI CCDG 1 cut(s) 126
MalI GATC 1 cut(s) 123
MbiI CCGCTC 1 cut(s) 160
MboI GATC 1 cut(s) 121
MboII GAAGA 1 cut(s) 138
MluCI AATT 3 cut(s) 37, 72, 90
MnlI CCTC 1 cut(s) 27
MseI TTAA 2 cut(s) 71, 171
NdeII GATC 1 cut(s) 121
NlaIII CATG 2 cut(s) 80, 139
NlaIV GGNNCC 2 cut(s) 145, 153
PshBI ATTAAT 1 cut(s) 71
PspN4I GGNNCC 2 cut(s) 145, 153
PspPI GGNCC 1 cut(s) 143
SaqAI TTAA 2 cut(s) 71, 171
Sau3AI GATC 1 cut(s) 121
Sau96I GGNCC 1 cut(s) 143
SetI ASST 2 cut(s) 19, 134
SgeI CNNG 8 cut(s) 32, 89, 148, 153, 160, 195, 197, 207
SinI GGWCC 1 cut(s) 143
Sse9I AATT 3 cut(s) 37, 72, 90
SsiI CCGC 1 cut(s) 158
StyI CCWWGG 1 cut(s) 147
TaaI ACNGT 1 cut(s) 33
TaqI TCGA 2 cut(s) 35, 124
TasI AATT 3 cut(s) 37, 72, 90
Tru1I TTAA 2 cut(s) 71, 171
Tru9I TTAA 2 cut(s) 71, 171
TscAI CASTG 1 cut(s) 105
TspDTI ATGAA 2 cut(s) 65, 179
TspRI CASTG 1 cut(s) 105
VpaK11BI GGWCC 1 cut(s) 143
VspI ATTAAT 1 cut(s) 71
XagI CCTNNNNNAGG 1 cut(s) 21
XapI RAATTY 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.