Rh7CG366900

Belongs to the terpene cyclase mutase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
45930038 .. 45935311
5274 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG366900.1

Sequence Viewer

Length: 105 bp
ATGGCGTTAATTCATGGTGGACAGATCTATACACCTCTTGAAGGAGACCGATCAAACTTGGTGCAGACCGTAATGGGATTAATGGGATTAATTCATGGTGGACAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

35

Amino Acids

3.71

Weight (kDa)

5.95

Isoelectric Point (pI)

29.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019328)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 41
AgsI TTSAA 1 cut(s) 41
Alw26I GTCTC 1 cut(s) 39
AseI ATTAAT 2 cut(s) 80, 89
BcoDI GTCTC 1 cut(s) 39
BglII AGATCT 1 cut(s) 24
BsaI GGTCTC 1 cut(s) 39
Bsc4I CCNNNNNNNGG 1 cut(s) 41
BseLI CCNNNNNNNGG 1 cut(s) 41
BsgI GTGCAG 1 cut(s) 83
BslI CCNNNNNNNGG 1 cut(s) 41
BsmAI GTCTC 1 cut(s) 39
Bso31I GGTCTC 1 cut(s) 39
Bsp143I GATC 2 cut(s) 24, 50
BspTNI GGTCTC 1 cut(s) 39
BssMI GATC 2 cut(s) 24, 50
Bst4CI ACNGT 1 cut(s) 70
BstENI CCTNNNNNAGG 1 cut(s) 39
BstKTI GATC 2 cut(s) 27, 53
BstMAI GTCTC 1 cut(s) 39
BstMBI GATC 2 cut(s) 24, 50
BstX2I RGATCY 1 cut(s) 24
BstYI RGATCY 1 cut(s) 24
CviAII CATG 2 cut(s) 14, 95
DpnI GATC 2 cut(s) 26, 52
DpnII GATC 2 cut(s) 24, 50
Eco31I GGTCTC 1 cut(s) 39
EcoNI CCTNNNNNAGG 1 cut(s) 39
FaeI CATG 2 cut(s) 17, 98
FaiI YATR 3 cut(s) 15, 30, 96
FatI CATG 2 cut(s) 13, 94
Hin1II CATG 2 cut(s) 17, 98
Hpy166II GTNNAC 2 cut(s) 20, 101
Hpy188III TCNNGA 1 cut(s) 38
Hpy8I GTNNAC 2 cut(s) 20, 101
HpyAV CCTTC 1 cut(s) 35
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4V TGCA 1 cut(s) 64
Hsp92II CATG 2 cut(s) 17, 98
Kzo9I GATC 2 cut(s) 24, 50
MalI GATC 2 cut(s) 26, 52
MboI GATC 2 cut(s) 24, 50
MflI RGATCY 1 cut(s) 24
MluCI AATT 2 cut(s) 9, 90
MnlI CCTC 1 cut(s) 45
MseI TTAA 3 cut(s) 8, 80, 89
NdeII GATC 2 cut(s) 24, 50
NlaIII CATG 2 cut(s) 17, 98
PshBI ATTAAT 2 cut(s) 80, 89
PsuI RGATCY 1 cut(s) 24
SaqAI TTAA 3 cut(s) 8, 80, 89
Sau3AI GATC 2 cut(s) 24, 50
SetI ASST 1 cut(s) 37
SgeI CNNG 3 cut(s) 26, 50, 70
Sse9I AATT 2 cut(s) 9, 90
TaaI ACNGT 1 cut(s) 70
TaqII GACCGA 1 cut(s) 63
TasI AATT 2 cut(s) 9, 90
Tru1I TTAA 3 cut(s) 8, 80, 89
Tru9I TTAA 3 cut(s) 8, 80, 89
TspDTI ATGAA 1 cut(s) 83
VspI ATTAAT 2 cut(s) 80, 89
XagI CCTNNNNNAGG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.