Rh4CG083400

Belongs to the terpene cyclase mutase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
14869980 .. 14870370
391 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG083400.1

Sequence Viewer

Length: 182 bp
ATGCCCTGTGAAATTGTGGGAGAAGCAATATCAGCTGATCAACTGCATGATGCTGTTAATGTAGTATTATCCCTACAGAACAGCAATGGAGGGTTTGCATCATATGAACTCACAAGATCCTATGCCTGGTTGGAGATGATCAATCCAGCTGAAACATTTGGAGATATCGTTATTGATTATCA
Functional Annotation

Protein Analysis

60

Amino Acids

6.58

Weight (kDa)

4.05

Isoelectric Point (pI)

34.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019328)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 111
AfiI CCNNNNNNNGG 1 cut(s) 126
AjnI CCWGG 1 cut(s) 125
AluBI AGCT 2 cut(s) 35, 149
AluI AGCT 2 cut(s) 35, 149
AlwI GGATC 1 cut(s) 111
BciT130I CCWGG 1 cut(s) 127
BclI TGATCA 2 cut(s) 37, 138
BfmI CTRYAG 1 cut(s) 74
Bme1390I CCNGG 1 cut(s) 127
BmrFI CCNGG 1 cut(s) 127
BmsI GCATC 2 cut(s) 40, 107
BsaXI ACNNNNNCTCC 1 cut(s) 153
Bsc4I CCNNNNNNNGG 1 cut(s) 126
Bse3DI GCAATG 1 cut(s) 91
BseBI CCWGG 1 cut(s) 127
BseLI CCNNNNNNNGG 1 cut(s) 126
BseMI GCAATG 1 cut(s) 91
BslI CCNNNNNNNGG 1 cut(s) 126
Bsp143I GATC 3 cut(s) 37, 116, 138
BspPI GGATC 1 cut(s) 111
BsrDI GCAATG 1 cut(s) 91
BssMI GATC 3 cut(s) 37, 116, 138
Bst2UI CCWGG 1 cut(s) 127
BstKTI GATC 3 cut(s) 40, 119, 141
BstMBI GATC 3 cut(s) 37, 116, 138
BstMWI GCNNNNNNNGC 1 cut(s) 32
BstNI CCWGG 1 cut(s) 127
BstSCI CCNGG 1 cut(s) 125
BstSFI CTRYAG 1 cut(s) 74
BstX2I RGATCY 1 cut(s) 116
BstYI RGATCY 1 cut(s) 116
CviAII CATG 1 cut(s) 47
CviJI RGCY 2 cut(s) 35, 149
CviKI_1 RGCY 2 cut(s) 35, 149
DpnI GATC 3 cut(s) 39, 118, 140
DpnII GATC 3 cut(s) 37, 116, 138
Eco32I GATATC 1 cut(s) 166
EcoRII CCWGG 1 cut(s) 125
EcoRV GATATC 1 cut(s) 166
FaeI CATG 1 cut(s) 50
FaiI YATR 4 cut(s) 48, 103, 105, 123
FatI CATG 1 cut(s) 46
FauNDI CATATG 1 cut(s) 103
FbaI TGATCA 2 cut(s) 37, 138
Hin1II CATG 1 cut(s) 50
HpyCH4V TGCA 2 cut(s) 46, 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
Hsp92II CATG 1 cut(s) 50
Ksp22I TGATCA 2 cut(s) 37, 138
Kzo9I GATC 3 cut(s) 37, 116, 138
LpnPI CCDG 4 cut(s) 19, 112, 139, 159
LweI GCATC 2 cut(s) 40, 107
MalI GATC 3 cut(s) 39, 118, 140
MboI GATC 3 cut(s) 37, 116, 138
MflI RGATCY 1 cut(s) 116
MluCI AATT 1 cut(s) 12
MmeI TCCRAC 1 cut(s) 111
MnlI CCTC 1 cut(s) 83
MseI TTAA 1 cut(s) 57
MspA1I CMGCKG 2 cut(s) 35, 149
MspR9I CCNGG 1 cut(s) 127
MvaI CCWGG 1 cut(s) 127
MwoI GCNNNNNNNGC 1 cut(s) 32
NdeI CATATG 1 cut(s) 103
NdeII GATC 3 cut(s) 37, 116, 138
NlaIII CATG 1 cut(s) 50
Psp6I CCWGG 1 cut(s) 125
PspGI CCWGG 1 cut(s) 125
PsuI RGATCY 1 cut(s) 116
PvuII CAGCTG 2 cut(s) 35, 149
SaqAI TTAA 1 cut(s) 57
Sau3AI GATC 3 cut(s) 37, 116, 138
ScrFI CCNGG 1 cut(s) 127
SetI ASST 2 cut(s) 37, 151
SfaNI GCATC 2 cut(s) 40, 107
SfcI CTRYAG 1 cut(s) 74
SgeI CNNG 6 cut(s) 18, 59, 126, 138, 139, 158
Sse9I AATT 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 125
TasI AATT 1 cut(s) 12
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
TspDTI ATGAA 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.