Rh2CG476900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
64251959 .. 64253375
1417 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG476900.1

Sequence Viewer

Length: 249 bp
ATGTGGATTCGCCTTGATCAGGTACGGGGAATTCGATTTGAGTTTACTGAGGGCGCAGCAGAGGCTATGAGCATGAGGATAGACGGAGCACCATATGGGGAAACATCCCACTTGATGTCATCACATCGATTGAAATCTCTTATCACGGTAAACTCAACATCCTTGCCCATCCAAATCGTGATTGCCCAGCAAAGAGTATCCACGAGTCTAAAGACCACTCTGAAAGCCATAAGACGTTGGGTAATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.32

Weight (kDa)

10.83

Isoelectric Point (pI)

33.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019071)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 30
AfaI GTAC 1 cut(s) 24
AfiI CCNNNNNNNGG 1 cut(s) 19
AgsI TTSAA 1 cut(s) 133
Alw21I GWGCWC 1 cut(s) 91
ApeKI GCWGC 1 cut(s) 56
ApoI RAATTY 1 cut(s) 30
AspLEI GCGC 1 cut(s) 56
BauI CACGAG 1 cut(s) 202
Bbv12I GWGCWC 1 cut(s) 91
BbvI GCAGC 1 cut(s) 68
BccI CCATC 1 cut(s) 176
BciVI GTATCC 1 cut(s) 208
BclI TGATCA 1 cut(s) 16
BfuI GTATCC 1 cut(s) 208
BisI GCNGC 1 cut(s) 57
BlsI GCNGC 1 cut(s) 58
Bsa29I ATCGAT 1 cut(s) 127
BsaBI GATNNNNATC 1 cut(s) 133
Bsc4I CCNNNNNNNGG 1 cut(s) 19
Bse8I GATNNNNATC 1 cut(s) 133
BseCI ATCGAT 1 cut(s) 127
BseGI GGATG 3 cut(s) 104, 158, 168
BseJI GATNNNNATC 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 19
BseMII CTCAG 1 cut(s) 39
BseXI GCAGC 1 cut(s) 68
BseYI CCCAGC 1 cut(s) 186
BshVI ATCGAT 1 cut(s) 127
BsiHKAI GWGCWC 1 cut(s) 91
BslI CCNNNNNNNGG 1 cut(s) 19
Bsp1286I GDGCHC 1 cut(s) 91
Bsp143I GATC 1 cut(s) 16
BspCNI CTCAG 1 cut(s) 40
BspDI ATCGAT 1 cut(s) 127
BssMI GATC 1 cut(s) 16
BssSI CACGAG 1 cut(s) 202
Bst2BI CACGAG 1 cut(s) 202
Bst4CI ACNGT 1 cut(s) 148
BstDEI CTNAG 1 cut(s) 48
BstENI CCTNNNNNAGG 1 cut(s) 17
BstF5I GGATG 3 cut(s) 104, 158, 168
BstHHI GCGC 1 cut(s) 56
BstKTI GATC 1 cut(s) 19
BstMBI GATC 1 cut(s) 16
BstMWI GCNNNNNNNGC 1 cut(s) 62
BstV1I GCAGC 1 cut(s) 68
Bsu15I ATCGAT 1 cut(s) 127
BsuI GTATCC 1 cut(s) 208
BsuTUI ATCGAT 1 cut(s) 127
BtsCI GGATG 3 cut(s) 104, 158, 168
CfoI GCGC 1 cut(s) 56
ClaI ATCGAT 1 cut(s) 127
Csp6I GTAC 1 cut(s) 23
CviAII CATG 1 cut(s) 73
CviJI RGCY 2 cut(s) 65, 227
CviKI_1 RGCY 2 cut(s) 65, 227
CviQI GTAC 1 cut(s) 23
DdeI CTNAG 1 cut(s) 48
DpnI GATC 1 cut(s) 18
DpnII GATC 1 cut(s) 16
EcoNI CCTNNNNNAGG 1 cut(s) 17
EcoRI GAATTC 1 cut(s) 30
FaeI CATG 1 cut(s) 76
FaiI YATR 5 cut(s) 68, 74, 94, 96, 230
FatI CATG 1 cut(s) 72
FauNDI CATATG 1 cut(s) 94
FbaI TGATCA 1 cut(s) 16
Fnu4HI GCNGC 1 cut(s) 57
FokI GGATG 3 cut(s) 91, 145, 155
Fsp4HI GCNGC 1 cut(s) 57
GlaI GCGC 1 cut(s) 55
GluI GCNGC 1 cut(s) 57
GsaI CCCAGC 1 cut(s) 190
HhaI GCGC 1 cut(s) 56
Hin1II CATG 1 cut(s) 76
Hin6I GCGC 1 cut(s) 54
HinP1I GCGC 1 cut(s) 54
HinfI GANTC 2 cut(s) 7, 205
Hpy166II GTNNAC 2 cut(s) 45, 151
Hpy188I TCNGA 1 cut(s) 222
Hpy188III TCNNGA 1 cut(s) 178
Hpy8I GTNNAC 2 cut(s) 45, 151
HpyCH4III ACNGT 1 cut(s) 148
HpyCH4IV ACGT 1 cut(s) 235
HpyF10VI GCNNNNNNNGC 1 cut(s) 62
HpyF3I CTNAG 1 cut(s) 48
HpySE526I ACGT 1 cut(s) 235
Hsp92II CATG 1 cut(s) 76
HspAI GCGC 1 cut(s) 54
Ksp22I TGATCA 1 cut(s) 16
Kzo9I GATC 1 cut(s) 16
LmnI GCTCC 1 cut(s) 86
LpnPI CCDG 2 cut(s) 5, 200
Lsp1109I GCAGC 1 cut(s) 68
MaeII ACGT 1 cut(s) 235
MalI GATC 1 cut(s) 18
MboI GATC 1 cut(s) 16
MhlI GDGCHC 1 cut(s) 91
MluCI AATT 1 cut(s) 30
MlyI GAGTC 1 cut(s) 214
MnlI CCTC 3 cut(s) 43, 55, 69
MwoI GCNNNNNNNGC 1 cut(s) 62
NdeI CATATG 1 cut(s) 94
NdeII GATC 1 cut(s) 16
NlaIII CATG 1 cut(s) 76
PcsI WCGNNNNNNNCGW 1 cut(s) 31
PfeI GAWTC 1 cut(s) 7
PkrI GCNGC 1 cut(s) 58
PleI GAGTC 1 cut(s) 213
PpsI GAGTC 1 cut(s) 213
PspFI CCCAGC 1 cut(s) 186
RsaI GTAC 1 cut(s) 24
RsaNI GTAC 1 cut(s) 23
SatI GCNGC 1 cut(s) 57
Sau3AI GATC 1 cut(s) 16
SchI GAGTC 1 cut(s) 214
SduI GDGCHC 1 cut(s) 91
SetI ASST 2 cut(s) 24, 238
Sse9I AATT 1 cut(s) 30
TaaI ACNGT 1 cut(s) 148
TaiI ACGT 1 cut(s) 238
TaqI TCGA 2 cut(s) 34, 127
TasI AATT 1 cut(s) 30
TfiI GAWTC 1 cut(s) 7
TseI GCWGC 1 cut(s) 56
TspGWI ACGGA 1 cut(s) 99
XagI CCTNNNNNAGG 1 cut(s) 17
XapI RAATTY 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.