Rh5AG003000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
230431 .. 236180
5750 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG003000.1

Sequence Viewer

Length: 234 bp
ATGTCATCGAGTGAGAAGGAGAAGCAAAATGAAGATTGCGAGCAGCTGTTTCTACAGTTGAGTGCGAATAAGATTCACTATTGCTGCTGTTTGAGAGTTGACAAGGAACTGTGTTTGGTTGCTAAAGTCAATGGTGGATTTTTTTTCCATCTGACTGAATTGGTCCTGGTTACTCTTCGGAAGGGAGTGGAAGAAGGGAAGAGATTCCTGCTTCATAAACCTTATTTCCTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.97

Weight (kDa)

7.64

Isoelectric Point (pI)

59.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020544)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0000361
rosa_rugosa Rorug04G0383300
rosa_samantha Rh5AG002900 Rh5AG003000 Rh5BG004100 Rh5CG003200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 165
AluBI AGCT 1 cut(s) 46
AluI AGCT 1 cut(s) 46
ApeKI GCWGC 2 cut(s) 43, 84
Asp700I GAANNNNTTC 1 cut(s) 203
AspS9I GGNCC 1 cut(s) 163
AvaII GGWCC 1 cut(s) 163
BbvI GCAGC 2 cut(s) 55, 71
BccI CCATC 1 cut(s) 156
BciT130I CCWGG 1 cut(s) 167
BfmI CTRYAG 1 cut(s) 53
BisI GCNGC 2 cut(s) 44, 85
BlsI GCNGC 2 cut(s) 45, 86
Bme1390I CCNGG 1 cut(s) 167
Bme18I GGWCC 1 cut(s) 163
BmgT120I GGNCC 1 cut(s) 163
BmrFI CCNGG 1 cut(s) 167
BseBI CCWGG 1 cut(s) 167
BseXI GCAGC 2 cut(s) 55, 71
Bst2UI CCWGG 1 cut(s) 167
Bst4CI ACNGT 2 cut(s) 57, 111
Bst6I CTCTTC 2 cut(s) 180, 194
BstC8I GCNNGC 1 cut(s) 41
BstNI CCWGG 1 cut(s) 167
BstSCI CCNGG 1 cut(s) 165
BstSFI CTRYAG 1 cut(s) 53
BstV1I GCAGC 2 cut(s) 55, 71
Cac8I GCNNGC 1 cut(s) 41
Cfr13I GGNCC 1 cut(s) 163
CviJI RGCY 1 cut(s) 46
CviKI_1 RGCY 1 cut(s) 46
Eam1104I CTCTTC 2 cut(s) 180, 194
EarI CTCTTC 2 cut(s) 180, 194
Eco47I GGWCC 1 cut(s) 163
EcoRII CCWGG 1 cut(s) 165
FaiI YATR 1 cut(s) 216
Fnu4HI GCNGC 2 cut(s) 44, 85
Fsp4HI GCNGC 2 cut(s) 44, 85
GluI GCNGC 2 cut(s) 44, 85
HincII GTYRAC 1 cut(s) 100
HindII GTYRAC 1 cut(s) 100
HinfI GANTC 2 cut(s) 73, 204
Hpy166II GTNNAC 1 cut(s) 100
Hpy188I TCNGA 3 cut(s) 153, 180, 233
Hpy8I GTNNAC 1 cut(s) 100
HpyAV CCTTC 3 cut(s) 10, 175, 188
HpyCH4III ACNGT 2 cut(s) 57, 111
LpnPI CCDG 3 cut(s) 152, 179, 221
Lsp1109I GCAGC 2 cut(s) 55, 71
MaeIII GTNAC 1 cut(s) 169
MboII GAAGA 4 cut(s) 44, 167, 203, 211
MluCI AATT 1 cut(s) 158
MroXI GAANNNNTTC 1 cut(s) 203
MspA1I CMGCKG 1 cut(s) 46
MspR9I CCNGG 1 cut(s) 167
MvaI CCWGG 1 cut(s) 167
PdmI GAANNNNTTC 1 cut(s) 203
PfeI GAWTC 2 cut(s) 73, 204
PkrI GCNGC 2 cut(s) 45, 86
Psp6I CCWGG 1 cut(s) 165
PspGI CCWGG 1 cut(s) 165
PspPI GGNCC 1 cut(s) 163
PvuII CAGCTG 1 cut(s) 46
SatI GCNGC 2 cut(s) 44, 85
Sau96I GGNCC 1 cut(s) 163
ScrFI CCNGG 1 cut(s) 167
SetI ASST 2 cut(s) 48, 223
SfcI CTRYAG 1 cut(s) 53
SgeI CNNG 6 cut(s) 21, 52, 115, 178, 179, 220
SinI GGWCC 1 cut(s) 163
Sse9I AATT 1 cut(s) 158
StyD4I CCNGG 1 cut(s) 165
TaaI ACNGT 2 cut(s) 57, 111
TaqI TCGA 1 cut(s) 8
TasI AATT 1 cut(s) 158
TfiI GAWTC 2 cut(s) 73, 204
TseI GCWGC 2 cut(s) 43, 84
TspDTI ATGAA 2 cut(s) 45, 203
VpaK11BI GGWCC 1 cut(s) 163
XmnI GAANNNNTTC 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.