Rh5AG400800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0019507
Physical Location & Seq
Reverse (-)
69393237 .. 69399096
5860 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG400800.1

Sequence Viewer

Length: 204 bp
ATGGAGAGACGCCTTGAACAAAATCAGCAGCATCTTTGGCTGGGCCAGAAGGACACGTTGTCCAACAAATCGCGGAATTTGTCTGCAGCAAACCTATTGAAATTGAGTCGACGGAAGATATTGAAACTCATGGAACTTTTGTTTTCAATGGCCTTGATCAACCTAAAAGGCGACCTGTGGGAGGAAGTGCATAATCGGCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.98

Weight (kDa)

10.27

Isoelectric Point (pI)

53.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019507)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000338.1_g000024 Rmu_sc0004482.1_g000009
rosa_samantha Rh5AG400800 Rh5AG401000 Rh5AG401100 Rh5AG401200 Rh5AG401800 Rh5CG438400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 109
AccII CGCG 1 cut(s) 73
AciI CCGC 1 cut(s) 73
AcsI RAATTY 1 cut(s) 76
AcyI GRCGYC 1 cut(s) 10
AfiI CCNNNNNNNGG 1 cut(s) 181
AflIII ACRYGT 1 cut(s) 54
AgsI TTSAA 4 cut(s) 17, 100, 124, 147
AhdI GACNNNNNGTC 1 cut(s) 58
AoxI GGCC 2 cut(s) 43, 150
ApeKI GCWGC 2 cut(s) 28, 86
ApoI RAATTY 1 cut(s) 76
AspS9I GGNCC 1 cut(s) 43
BbvI GCAGC 2 cut(s) 40, 98
BclI TGATCA 1 cut(s) 156
BfmI CTRYAG 1 cut(s) 84
BisI GCNGC 2 cut(s) 29, 87
BlsI GCNGC 2 cut(s) 30, 88
BmeRI GACNNNNNGTC 1 cut(s) 58
BmgT120I GGNCC 1 cut(s) 43
BmsI GCATC 1 cut(s) 40
BsaHI GRCGYC 1 cut(s) 10
Bsc4I CCNNNNNNNGG 1 cut(s) 181
BseLI CCNNNNNNNGG 1 cut(s) 181
BseXI GCAGC 2 cut(s) 40, 98
BseYI CCCAGC 1 cut(s) 40
Bsh1236I CGCG 1 cut(s) 73
BshFI GGCC 2 cut(s) 45, 152
BslI CCNNNNNNNGG 1 cut(s) 181
BsnI GGCC 2 cut(s) 45, 152
Bsp143I GATC 1 cut(s) 156
BspACI CCGC 1 cut(s) 73
BspANI GGCC 2 cut(s) 45, 152
BspFNI CGCG 1 cut(s) 73
BspMAI CTGCAG 1 cut(s) 88
BssMI GATC 1 cut(s) 156
BssNI GRCGYC 1 cut(s) 10
BstACI GRCGYC 1 cut(s) 10
BstENI CCTNNNNNAGG 1 cut(s) 179
BstFNI CGCG 1 cut(s) 73
BstKTI GATC 1 cut(s) 159
BstMBI GATC 1 cut(s) 156
BstMWI GCNNNNNNNGC 2 cut(s) 37, 196
BstSFI CTRYAG 1 cut(s) 84
BstUI CGCG 1 cut(s) 73
BstV1I GCAGC 2 cut(s) 40, 98
BsuRI GGCC 2 cut(s) 45, 152
Cfr13I GGNCC 1 cut(s) 43
CseI GACGC 1 cut(s) 18
CviAII CATG 1 cut(s) 130
CviJI RGCY 4 cut(s) 40, 45, 152, 199
CviKI_1 RGCY 4 cut(s) 40, 45, 152, 199
DpnI GATC 1 cut(s) 158
DpnII GATC 1 cut(s) 156
DriI GACNNNNNGTC 1 cut(s) 58
Eam1105I GACNNNNNGTC 1 cut(s) 58
EcoNI CCTNNNNNAGG 1 cut(s) 179
FaeI CATG 1 cut(s) 133
FaiI YATR 3 cut(s) 131, 192, 202
FatI CATG 1 cut(s) 129
FbaI TGATCA 1 cut(s) 156
FblI GTMKAC 1 cut(s) 109
Fnu4HI GCNGC 2 cut(s) 29, 87
Fsp4HI GCNGC 2 cut(s) 29, 87
GluI GCNGC 2 cut(s) 29, 87
GsaI CCCAGC 1 cut(s) 44
HaeIII GGCC 2 cut(s) 45, 152
HgaI GACGC 1 cut(s) 18
Hin1I GRCGYC 1 cut(s) 10
Hin1II CATG 1 cut(s) 133
HincII GTYRAC 1 cut(s) 110
HindII GTYRAC 1 cut(s) 110
HinfI GANTC 1 cut(s) 106
Hpy166II GTNNAC 1 cut(s) 110
Hpy8I GTNNAC 1 cut(s) 110
Hpy99I CGWCG 1 cut(s) 114
HpyAV CCTTC 1 cut(s) 43
HpyCH4IV ACGT 1 cut(s) 56
HpyCH4V TGCA 2 cut(s) 86, 190
HpyF10VI GCNNNNNNNGC 2 cut(s) 37, 196
HpySE526I ACGT 1 cut(s) 56
Hsp92I GRCGYC 1 cut(s) 10
Hsp92II CATG 1 cut(s) 133
Ksp22I TGATCA 1 cut(s) 156
Kzo9I GATC 1 cut(s) 156
LpnPI CCDG 3 cut(s) 26, 59, 188
Lsp1109I GCAGC 2 cut(s) 40, 98
LweI GCATC 1 cut(s) 40
MaeII ACGT 1 cut(s) 56
MalI GATC 1 cut(s) 158
MboI GATC 1 cut(s) 156
MboII GAAGA 1 cut(s) 127
MluCI AATT 2 cut(s) 76, 101
MlyI GAGTC 1 cut(s) 115
MmeI TCCRAC 1 cut(s) 87
MnlI CCTC 1 cut(s) 175
MvnI CGCG 1 cut(s) 73
MwoI GCNNNNNNNGC 2 cut(s) 37, 196
NdeII GATC 1 cut(s) 156
NlaIII CATG 1 cut(s) 133
PkrI GCNGC 2 cut(s) 30, 88
PleI GAGTC 1 cut(s) 114
PpsI GAGTC 1 cut(s) 114
PspFI CCCAGC 1 cut(s) 40
PspPI GGNCC 1 cut(s) 43
PstI CTGCAG 1 cut(s) 88
SalI GTCGAC 1 cut(s) 108
SatI GCNGC 2 cut(s) 29, 87
Sau3AI GATC 1 cut(s) 156
Sau96I GGNCC 1 cut(s) 43
SchI GAGTC 1 cut(s) 115
SetI ASST 4 cut(s) 59, 96, 165, 177
SfaNI GCATC 1 cut(s) 40
SfcI CTRYAG 1 cut(s) 84
SgeI CNNG 8 cut(s) 26, 53, 58, 67, 84, 142, 166, 187
Sse9I AATT 2 cut(s) 76, 101
SsiI CCGC 1 cut(s) 73
TaiI ACGT 1 cut(s) 59
TaqI TCGA 1 cut(s) 109
TasI AATT 2 cut(s) 76, 101
TseI GCWGC 2 cut(s) 28, 86
TspGWI ACGGA 1 cut(s) 127
XagI CCTNNNNNAGG 1 cut(s) 179
XapI RAATTY 1 cut(s) 76
XmiI GTMKAC 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.