Rh5DG395500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0018370
Physical Location & Seq
Forward (+)
62029353 .. 62035405
6053 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG395500.1

Sequence Viewer

Length: 381 bp
ATGATTGAGGATCTTGAGGATCCCATCCATGAGATTACTTTCCTGGATATAACAAGCGTAATCCTTGCCAAGGTGATCGATTACCTCAACATGCACGAGAAGCGAAACGCTGCTTATGTCGGCACTAAGGCTGTCCACAACTTTGATGCCGAGTTCGTCAAGGGAAGAACATCAATGGACCACCCAGCCCCAAATCAGACCAATCGATTGAAACGAAAACTCAAATTCAGCCCCAAAATAATAAAAGGTGCAAAAACACAAATCTCAAGCTGTAGACCAATCGACGGCCGCATCGTCCTCCACTCCATATCTGAAAAGGAAACGACGTGTTCTCTATCACCGCTTTCCCTTCCTCCAAACCTAGTAAGCTTTACTAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

126

Amino Acids

14.19

Weight (kDa)

9.2

Isoelectric Point (pI)

43.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 274
AciI CCGC 2 cut(s) 289, 341
AclWI GGATC 3 cut(s) 14, 18, 27
AcoI YGGCCR 1 cut(s) 286
AcsI RAATTY 1 cut(s) 224
AfiI CCNNNNNNNGG 2 cut(s) 70, 284
AflIII ACRYGT 1 cut(s) 326
AgsI TTSAA 1 cut(s) 211
AjiI CACGTC 1 cut(s) 327
AjnI CCWGG 1 cut(s) 42
AluBI AGCT 2 cut(s) 270, 369
AluI AGCT 2 cut(s) 270, 369
AlwI GGATC 3 cut(s) 14, 18, 27
AoxI GGCC 1 cut(s) 286
ApeKI GCWGC 1 cut(s) 110
ApoI RAATTY 1 cut(s) 224
AspS9I GGNCC 1 cut(s) 178
AsuHPI GGTGA 2 cut(s) 85, 330
AvaII GGWCC 1 cut(s) 178
BamHI GGATCC 1 cut(s) 19
BauI CACGAG 1 cut(s) 95
BbvI GCAGC 1 cut(s) 97
BccI CCATC 1 cut(s) 32
BceAI ACGGC 1 cut(s) 301
BciT130I CCWGG 1 cut(s) 44
BfaI CTAG 2 cut(s) 362, 375
BfmI CTRYAG 1 cut(s) 271
BisI GCNGC 2 cut(s) 111, 289
BlsI GCNGC 2 cut(s) 112, 290
Bme1390I CCNGG 1 cut(s) 44
Bme18I GGWCC 1 cut(s) 178
BmgBI CACGTC 1 cut(s) 327
BmgT120I GGNCC 1 cut(s) 178
BmiI GGNNCC 1 cut(s) 21
BmrFI CCNGG 1 cut(s) 44
BmsI GCATC 2 cut(s) 136, 300
BpuEI CTTGAG 2 cut(s) 35, 250
Bsa29I ATCGAT 2 cut(s) 78, 205
BsaJI CCNNGG 1 cut(s) 69
Bsc4I CCNNNNNNNGG 2 cut(s) 70, 284
BseBI CCWGG 1 cut(s) 44
BseCI ATCGAT 2 cut(s) 78, 205
BseDI CCNNGG 1 cut(s) 69
BseGI GGATG 1 cut(s) 24
BseLI CCNNNNNNNGG 2 cut(s) 70, 284
BseX3I CGGCCG 1 cut(s) 286
BseXI GCAGC 1 cut(s) 97
BseYI CCCAGC 1 cut(s) 184
Bsh1285I CGRYCG 1 cut(s) 289
BshFI GGCC 1 cut(s) 288
BshVI ATCGAT 2 cut(s) 78, 205
BsiEI CGRYCG 1 cut(s) 289
BslI CCNNNNNNNGG 2 cut(s) 70, 284
BsnI GGCC 1 cut(s) 288
Bsp143I GATC 3 cut(s) 10, 19, 75
BspACI CCGC 2 cut(s) 289, 341
BspANI GGCC 1 cut(s) 288
BspDI ATCGAT 2 cut(s) 78, 205
BspLI GGNNCC 1 cut(s) 21
BspPI GGATC 3 cut(s) 14, 18, 27
BssECI CCNNGG 1 cut(s) 69
BssMI GATC 3 cut(s) 10, 19, 75
BssSI CACGAG 1 cut(s) 95
BssT1I CCWWGG 1 cut(s) 69
Bst2BI CACGAG 1 cut(s) 95
Bst2UI CCWGG 1 cut(s) 44
BstDEI CTNAG 1 cut(s) 126
BstENI CCTNNNNNAGG 1 cut(s) 68
BstF5I GGATG 1 cut(s) 24
BstKTI GATC 3 cut(s) 13, 22, 78
BstMBI GATC 3 cut(s) 10, 19, 75
BstMCI CGRYCG 1 cut(s) 289
BstMWI GCNNNNNNNGC 1 cut(s) 100
BstNI CCWGG 1 cut(s) 44
BstNSI RCATGY 1 cut(s) 94
BstSCI CCNGG 1 cut(s) 42
BstSFI CTRYAG 1 cut(s) 271
BstV1I GCAGC 1 cut(s) 97
BstX2I RGATCY 2 cut(s) 10, 19
BstYI RGATCY 2 cut(s) 10, 19
BstZI CGGCCG 1 cut(s) 286
Bsu15I ATCGAT 2 cut(s) 78, 205
BsuRI GGCC 1 cut(s) 288
BsuTUI ATCGAT 2 cut(s) 78, 205
BtrI CACGTC 1 cut(s) 327
BtsCI GGATG 1 cut(s) 24
Cfr13I GGNCC 1 cut(s) 178
ClaI ATCGAT 2 cut(s) 78, 205
CviAII CATG 2 cut(s) 29, 91
CviJI RGCY 6 cut(s) 131, 188, 231, 270, 288, 369
CviKI_1 RGCY 6 cut(s) 131, 188, 231, 270, 288, 369
DdeI CTNAG 1 cut(s) 126
DpnI GATC 3 cut(s) 12, 21, 77
DpnII GATC 3 cut(s) 10, 19, 75
EaeI YGGCCR 1 cut(s) 286
EagI CGGCCG 1 cut(s) 286
EclXI CGGCCG 1 cut(s) 286
Eco130I CCWWGG 1 cut(s) 69
Eco47I GGWCC 1 cut(s) 178
Eco52I CGGCCG 1 cut(s) 286
EcoNI CCTNNNNNAGG 1 cut(s) 68
EcoRII CCWGG 1 cut(s) 42
EcoT14I CCWWGG 1 cut(s) 69
ErhI CCWWGG 1 cut(s) 69
FaeI CATG 2 cut(s) 32, 94
FaiI YATR 5 cut(s) 30, 50, 92, 117, 308
FatI CATG 2 cut(s) 28, 90
FblI GTMKAC 1 cut(s) 274
Fnu4HI GCNGC 2 cut(s) 111, 289
FokI GGATG 1 cut(s) 11
Fsp4HI GCNGC 2 cut(s) 111, 289
FspBI CTAG 2 cut(s) 362, 375
GluI GCNGC 2 cut(s) 111, 289
GsaI CCCAGC 1 cut(s) 188
HaeIII GGCC 1 cut(s) 288
Hin1II CATG 2 cut(s) 32, 94
HindIII AAGCTT 1 cut(s) 367
HphI GGTGA 2 cut(s) 85, 330
Hpy166II GTNNAC 2 cut(s) 136, 275
Hpy188I TCNGA 2 cut(s) 198, 313
Hpy188III TCNNGA 1 cut(s) 14
Hpy8I GTNNAC 2 cut(s) 136, 275
Hpy99I CGWCG 2 cut(s) 287, 328
HpyAV CCTTC 1 cut(s) 359
HpyCH4IV ACGT 1 cut(s) 326
HpyCH4V TGCA 2 cut(s) 94, 251
HpyF10VI GCNNNNNNNGC 1 cut(s) 100
HpyF3I CTNAG 1 cut(s) 126
HpySE526I ACGT 1 cut(s) 326
Hsp92II CATG 2 cut(s) 32, 94
Kzo9I GATC 3 cut(s) 10, 19, 75
LpnPI CCDG 3 cut(s) 29, 56, 198
Lsp1109I GCAGC 1 cut(s) 97
LweI GCATC 2 cut(s) 136, 300
MaeI CTAG 2 cut(s) 362, 375
MaeII ACGT 1 cut(s) 326
MalI GATC 3 cut(s) 12, 21, 77
MboI GATC 3 cut(s) 10, 19, 75
MboII GAAGA 1 cut(s) 177
MflI RGATCY 2 cut(s) 10, 19
MluCI AATT 1 cut(s) 224
MnlI CCTC 4 cut(s) 10, 95, 308, 363
MspR9I CCNGG 1 cut(s) 44
MvaI CCWGG 1 cut(s) 44
MwoI GCNNNNNNNGC 1 cut(s) 100
NdeII GATC 3 cut(s) 10, 19, 75
NlaIII CATG 2 cut(s) 32, 94
NlaIV GGNNCC 1 cut(s) 21
NmeAIII GCCGAG 1 cut(s) 175
NspI RCATGY 1 cut(s) 94
PcsI WCGNNNNNNNCGW 2 cut(s) 211, 291
PfoI TCCNGGA 1 cut(s) 42
PkrI GCNGC 2 cut(s) 112, 290
Psp6I CCWGG 1 cut(s) 42
PspFI CCCAGC 1 cut(s) 184
PspGI CCWGG 1 cut(s) 42
PspN4I GGNNCC 1 cut(s) 21
PspPI GGNCC 1 cut(s) 178
PsuI RGATCY 2 cut(s) 10, 19
SatI GCNGC 2 cut(s) 111, 289
Sau3AI GATC 3 cut(s) 10, 19, 75
Sau96I GGNCC 1 cut(s) 178
ScrFI CCNGG 1 cut(s) 44
SetI ASST 8 cut(s) 75, 87, 250, 272, 329, 363, 371, 380
SfaNI GCATC 2 cut(s) 136, 300
SfcI CTRYAG 1 cut(s) 271
SinI GGWCC 1 cut(s) 178
SmlI CTYRAG 2 cut(s) 14, 265
SmoI CTYRAG 2 cut(s) 14, 265
Sse9I AATT 1 cut(s) 224
SsiI CCGC 2 cut(s) 289, 341
SspMI CTAG 2 cut(s) 362, 375
StyD4I CCNGG 1 cut(s) 42
StyI CCWWGG 1 cut(s) 69
TaiI ACGT 1 cut(s) 329
TaqI TCGA 3 cut(s) 78, 205, 282
TasI AATT 1 cut(s) 224
TauI GCSGC 1 cut(s) 291
TseI GCWGC 1 cut(s) 110
VpaK11BI GGWCC 1 cut(s) 178
XagI CCTNNNNNAGG 1 cut(s) 68
XapI RAATTY 1 cut(s) 224
XceI RCATGY 1 cut(s) 94
XmiI GTMKAC 1 cut(s) 274
XspI CTAG 2 cut(s) 362, 375
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.