Rh6AG125200
ERF Family

Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
18729372 .. 18729883
512 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG125200.1

Sequence Viewer

Length: 198 bp
ATGGAAGTCCTTTTTGGGAAGTTCCACAAGTGGAAACAGGCCAATGCTCCGGTCAAGAATAAGCAGGTGGATCATAATAGTAATGGAAATAACACCGCCAACGATGACATCTTTATCATCTGGCTCGAGCAGGGAGGGTCTCCTCCAAATATTGGACAATTGAAATGTAAGATACCATTTGTAGATGGGAAAAGATAG

Protein Analysis

65

Amino Acids

7.33

Weight (kDa)

9.3

Isoelectric Point (pI)

48.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019263)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 55
Acc36I ACCTGC 1 cut(s) 55
AccB7I CCANNNNNTGG 1 cut(s) 152
AciI CCGC 1 cut(s) 96
AclWI GGATC 1 cut(s) 78
AfiI CCNNNNNNNGG 1 cut(s) 152
AgsI TTSAA 1 cut(s) 163
AjuI GAANNNNNNNTTGG 1 cut(s) 29
Alw26I GTCTC 1 cut(s) 144
AlwI GGATC 1 cut(s) 78
Ama87I CYCGRG 1 cut(s) 125
AoxI GGCC 1 cut(s) 39
AvaI CYCGRG 1 cut(s) 125
BccI CCATC 1 cut(s) 179
BcoDI GTCTC 1 cut(s) 144
BfuAI ACCTGC 1 cut(s) 55
BmeT110I CYCGRG 1 cut(s) 125
BsaI GGTCTC 1 cut(s) 144
BsaWI WCCGGW 1 cut(s) 49
Bsc4I CCNNNNNNNGG 1 cut(s) 152
BseLI CCNNNNNNNGG 1 cut(s) 152
BseRI GAGGAG 1 cut(s) 132
BshFI GGCC 1 cut(s) 41
BsiHKCI CYCGRG 1 cut(s) 125
BsiSI CCGG 1 cut(s) 50
BslI CCNNNNNNNGG 1 cut(s) 152
BsmAI GTCTC 1 cut(s) 144
BsnI GGCC 1 cut(s) 41
Bso31I GGTCTC 1 cut(s) 144
BsoBI CYCGRG 1 cut(s) 125
Bsp143I GATC 1 cut(s) 70
BspACI CCGC 1 cut(s) 96
BspANI GGCC 1 cut(s) 41
BspMI ACCTGC 1 cut(s) 55
BspPI GGATC 1 cut(s) 78
BspTNI GGTCTC 1 cut(s) 144
BssMI GATC 1 cut(s) 70
BstKTI GATC 1 cut(s) 73
BstMAI GTCTC 1 cut(s) 144
BstMBI GATC 1 cut(s) 70
BsuRI GGCC 1 cut(s) 41
BveI ACCTGC 1 cut(s) 55
CviJI RGCY 2 cut(s) 41, 124
CviKI_1 RGCY 2 cut(s) 41, 124
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
Eco31I GGTCTC 1 cut(s) 144
Eco88I CYCGRG 1 cut(s) 125
FaiI YATR 1 cut(s) 75
HaeIII GGCC 1 cut(s) 41
HapII CCGG 1 cut(s) 50
HpaII CCGG 1 cut(s) 50
Hpy188III TCNNGA 1 cut(s) 55
Kzo9I GATC 1 cut(s) 70
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 5 cut(s) 23, 50, 63, 106, 116
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MfeI CAATTG 1 cut(s) 158
MluCI AATT 1 cut(s) 158
MnlI CCTC 2 cut(s) 128, 153
MspI CCGG 1 cut(s) 50
MunI CAATTG 1 cut(s) 158
NdeII GATC 1 cut(s) 70
PaeR7I CTCGAG 1 cut(s) 125
PaqCI CACCTGC 1 cut(s) 55
PflMI CCANNNNNTGG 1 cut(s) 152
PspXI VCTCGAGB 1 cut(s) 125
Sau3AI GATC 1 cut(s) 70
SetI ASST 1 cut(s) 69
Sfr274I CTCGAG 1 cut(s) 125
SgeI CNNG 9 cut(s) 40, 50, 62, 67, 77, 133, 137, 139, 143
SlaI CTCGAG 1 cut(s) 125
SmlI CTYRAG 1 cut(s) 125
SmoI CTYRAG 1 cut(s) 125
Sse9I AATT 1 cut(s) 158
SsiI CCGC 1 cut(s) 96
SspI AATATT 1 cut(s) 151
TaqI TCGA 1 cut(s) 126
TasI AATT 1 cut(s) 158
Van91I CCANNNNNTGG 1 cut(s) 152
XhoI CTCGAG 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.