Rh6AG207200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
36972987 .. 36973780
794 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG207200.1

Sequence Viewer

Length: 225 bp
ATGGATGACGGGGAACAAGAAGGTTATGATGATAATGAGGTTGGAATGGATGAGGAGTTAGCGATGGGCCTAGAACACCTGCACGATAATGATGCGTCACATTCTGCCCTTAATTCACGCATGAGCTATGTATGGTCAAATGACAAAATTAAAATGATTAATATTGTTGACTCAAAGTTCGACTTTTGGGATGAACTTCACCTATTTGAATCCGAGAAGCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.65

Weight (kDa)

4.15

Isoelectric Point (pI)

42.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020640)

Species Orthologous Gene IDs
rosa_laevigata RLG00000013336
rosa_roxburghii Rroxscaffold_7G00193090
rosa_rugosa Rorug06G0094900
rosa_samantha Rh6AG207200
rosa_wichuraiana Rw6G017970 Rw6G017990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 87
Acc36I ACCTGC 1 cut(s) 87
AgsI TTSAA 1 cut(s) 209
AluBI AGCT 1 cut(s) 126
AluI AGCT 1 cut(s) 126
AoxI GGCC 1 cut(s) 67
ArsI GACNNNNNNTTYG 2 cut(s) 161, 193
AseI ATTAAT 1 cut(s) 159
AspS9I GGNCC 1 cut(s) 67
AsuHPI GGTGA 1 cut(s) 191
BccI CCATC 1 cut(s) 58
BcgI CGANNNNNNTGC 2 cut(s) 74, 108
BfaI CTAG 1 cut(s) 71
BfuAI ACCTGC 1 cut(s) 87
BmgT120I GGNCC 1 cut(s) 67
BmsI GCATC 1 cut(s) 82
BseGI GGATG 3 cut(s) 10, 55, 196
BseRI GAGGAG 1 cut(s) 68
BsgI GTGCAG 1 cut(s) 65
BshFI GGCC 1 cut(s) 69
BsnI GGCC 1 cut(s) 69
BspANI GGCC 1 cut(s) 69
BspMI ACCTGC 1 cut(s) 87
BstF5I GGATG 3 cut(s) 10, 55, 196
BsuRI GGCC 1 cut(s) 69
BtgZI GCGATG 1 cut(s) 77
BtsCI GGATG 3 cut(s) 10, 55, 196
BveI ACCTGC 1 cut(s) 87
Cfr13I GGNCC 1 cut(s) 67
CseI GACGC 1 cut(s) 84
CviAII CATG 1 cut(s) 121
CviJI RGCY 2 cut(s) 69, 126
CviKI_1 RGCY 2 cut(s) 69, 126
FaeI CATG 1 cut(s) 124
FaiI YATR 4 cut(s) 27, 122, 129, 133
FalI AAGNNNNNCTT 2 cut(s) 167, 199
FatI CATG 1 cut(s) 120
FokI GGATG 3 cut(s) 17, 62, 203
FspBI CTAG 1 cut(s) 71
HaeIII GGCC 1 cut(s) 69
HgaI GACGC 1 cut(s) 84
Hin1II CATG 1 cut(s) 124
HincII GTYRAC 1 cut(s) 169
HindII GTYRAC 1 cut(s) 169
HinfI GANTC 2 cut(s) 170, 209
HphI GGTGA 1 cut(s) 191
Hpy166II GTNNAC 1 cut(s) 169
Hpy188I TCNGA 1 cut(s) 214
Hpy8I GTNNAC 1 cut(s) 169
HpyAV CCTTC 1 cut(s) 14
HpyCH4V TGCA 1 cut(s) 82
Hsp92II CATG 1 cut(s) 124
LpnPI CCDG 1 cut(s) 92
LweI GCATC 1 cut(s) 82
MaeI CTAG 1 cut(s) 71
MaeIII GTNAC 1 cut(s) 96
MluCI AATT 2 cut(s) 112, 147
MlyI GAGTC 1 cut(s) 164
MmeI TCCRAC 1 cut(s) 22
MnlI CCTC 2 cut(s) 31, 46
MseI TTAA 3 cut(s) 111, 150, 159
MslI CAYNNNNRTG 1 cut(s) 87
NlaIII CATG 1 cut(s) 124
NmuCI GTSAC 1 cut(s) 96
PaqCI CACCTGC 1 cut(s) 87
PfeI GAWTC 1 cut(s) 209
PleI GAGTC 1 cut(s) 164
PpsI GAGTC 1 cut(s) 164
PshBI ATTAAT 1 cut(s) 159
PspPI GGNCC 1 cut(s) 67
RseI CAYNNNNRTG 1 cut(s) 87
SaqAI TTAA 3 cut(s) 111, 150, 159
Sau96I GGNCC 1 cut(s) 67
SchI GAGTC 1 cut(s) 164
SetI ASST 5 cut(s) 25, 42, 81, 128, 204
SfaNI GCATC 1 cut(s) 82
SgeI CNNG 7 cut(s) 22, 29, 83, 91, 95, 129, 133
SmiMI CAYNNNNRTG 1 cut(s) 87
Sse9I AATT 2 cut(s) 112, 147
SspI AATATT 1 cut(s) 163
SspMI CTAG 1 cut(s) 71
TaqI TCGA 1 cut(s) 180
TasI AATT 2 cut(s) 112, 147
TfiI GAWTC 1 cut(s) 209
Tru1I TTAA 3 cut(s) 111, 150, 159
Tru9I TTAA 3 cut(s) 111, 150, 159
TseFI GTSAC 1 cut(s) 96
Tsp45I GTSAC 1 cut(s) 96
TspDTI ATGAA 1 cut(s) 207
VspI ATTAAT 1 cut(s) 159
XspI CTAG 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.