Rh7AG465700
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
64258296 .. 64258696
401 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG465700.1

Sequence Viewer

Length: 207 bp
ATGATGAAATCCAACAGTTTAGATAAGGCTCCGACTCAGTCCCTTTTAAGTGTTGTAAATGGAATTCTTGATGAAAGCGTTGAAAGAAATAATAGTGAAATACCTCATCGTGTGGCTTGTCTACTCAGAAAATATTTGCCTTTGCTAATTGAAGATGCTATTGGTACTACAATAGCTTGGCCATCTGACAAAGTTGTTATTCTTTGA

Protein Analysis

68

Amino Acids

7.52

Weight (kDa)

5.64

Isoelectric Point (pI)

51.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019886)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 121
AcoI YGGCCR 1 cut(s) 179
AcsI RAATTY 1 cut(s) 63
AfaI GTAC 1 cut(s) 166
AgsI TTSAA 2 cut(s) 83, 152
AjuI GAANNNNNNNTTGG 2 cut(s) 144, 176
AluBI AGCT 1 cut(s) 176
AluI AGCT 1 cut(s) 176
AoxI GGCC 1 cut(s) 179
ApoI RAATTY 1 cut(s) 63
BalI TGGCCA 1 cut(s) 181
BccI CCATC 1 cut(s) 190
BmiI GGNNCC 1 cut(s) 30
BmsI GCATC 1 cut(s) 145
BseMII CTCAG 2 cut(s) 50, 139
BshFI GGCC 1 cut(s) 181
BslFI GGGAC 1 cut(s) 25
BsmFI GGGAC 1 cut(s) 25
BsnI GGCC 1 cut(s) 181
BspANI GGCC 1 cut(s) 181
BspCNI CTCAG 2 cut(s) 49, 138
BspLI GGNNCC 1 cut(s) 30
Bst4CI ACNGT 1 cut(s) 17
BstDEI CTNAG 2 cut(s) 36, 125
BsuRI GGCC 1 cut(s) 181
Csp6I GTAC 1 cut(s) 165
CviJI RGCY 4 cut(s) 29, 116, 176, 181
CviKI_1 RGCY 4 cut(s) 29, 116, 176, 181
CviQI GTAC 1 cut(s) 165
DdeI CTNAG 2 cut(s) 36, 125
EaeI YGGCCR 1 cut(s) 179
EcoRI GAATTC 1 cut(s) 63
FaqI GGGAC 1 cut(s) 25
FblI GTMKAC 1 cut(s) 121
HaeIII GGCC 1 cut(s) 181
HinfI GANTC 1 cut(s) 34
Hpy166II GTNNAC 1 cut(s) 122
Hpy188I TCNGA 3 cut(s) 33, 128, 187
Hpy188III TCNNGA 1 cut(s) 68
Hpy8I GTNNAC 1 cut(s) 122
HpyCH4III ACNGT 1 cut(s) 17
HpyF3I CTNAG 2 cut(s) 36, 125
LmnI GCTCC 1 cut(s) 34
LweI GCATC 1 cut(s) 145
MboII GAAGA 1 cut(s) 164
MlsI TGGCCA 1 cut(s) 181
MluCI AATT 2 cut(s) 63, 147
MluNI TGGCCA 1 cut(s) 181
MlyI GAGTC 1 cut(s) 28
MmeI TCCRAC 2 cut(s) 36, 56
MnlI CCTC 1 cut(s) 114
Mox20I TGGCCA 1 cut(s) 181
MscI TGGCCA 1 cut(s) 181
MseI TTAA 1 cut(s) 47
Msp20I TGGCCA 1 cut(s) 181
NlaIV GGNNCC 1 cut(s) 30
PflFI GACNNNGTC 1 cut(s) 37
PleI GAGTC 1 cut(s) 28
PpsI GAGTC 1 cut(s) 28
PspN4I GGNNCC 1 cut(s) 30
PsyI GACNNNGTC 1 cut(s) 37
RsaI GTAC 1 cut(s) 166
RsaNI GTAC 1 cut(s) 165
SaqAI TTAA 1 cut(s) 47
SchI GAGTC 1 cut(s) 28
SetI ASST 2 cut(s) 106, 178
SfaNI GCATC 1 cut(s) 145
SgeI CNNG 4 cut(s) 80, 122, 129, 189
Sse9I AATT 2 cut(s) 63, 147
SspI AATATT 1 cut(s) 134
TaaI ACNGT 1 cut(s) 17
TasI AATT 2 cut(s) 63, 147
Tru1I TTAA 1 cut(s) 47
Tru9I TTAA 1 cut(s) 47
TspDTI ATGAA 2 cut(s) 20, 87
Tth111I GACNNNGTC 1 cut(s) 37
XapI RAATTY 1 cut(s) 63
XmiI GTMKAC 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.