Rh7CG157800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
12935497 .. 12938443
2947 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG157800.1

Sequence Viewer

Length: 186 bp
ATGCTGAGTGAATGTCTCTCGCCGTCTTCCATTCTCCACTTCTCTCAAAAAGATCAATTGATTCAATTCAATGCTGTTCAAAACTATCTGCCAGTTCTCGACAGGAAATTGACTGGAGTGACCTTCTATACTCCCGACCCGCAACTTCTCTACATATGTGGAACTAAGTGTCATGCTTCAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.9

Weight (kDa)

6.01

Isoelectric Point (pI)

56.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018969)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 140
AcuI CTGAAG 1 cut(s) 162
AgsI TTSAA 3 cut(s) 65, 70, 80
Alw26I GTCTC 1 cut(s) 20
BbsI GAAGAC 1 cut(s) 18
BceAI ACGGC 1 cut(s) 7
BcoDI GTCTC 1 cut(s) 20
BpiI GAAGAC 1 cut(s) 18
BpmI CTGGAG 1 cut(s) 135
Bse1I ACTGG 2 cut(s) 92, 118
BseNI ACTGG 2 cut(s) 92, 118
BsmAI GTCTC 1 cut(s) 20
Bsp143I GATC 1 cut(s) 52
BspACI CCGC 1 cut(s) 140
BsrI ACTGG 2 cut(s) 92, 118
BssMI GATC 1 cut(s) 52
BstDEI CTNAG 2 cut(s) 5, 165
BstKTI GATC 1 cut(s) 55
BstMAI GTCTC 1 cut(s) 20
BstMBI GATC 1 cut(s) 52
BstV2I GAAGAC 1 cut(s) 18
CviAII CATG 1 cut(s) 173
DdeI CTNAG 2 cut(s) 5, 165
DpnI GATC 1 cut(s) 54
DpnII GATC 1 cut(s) 52
Eco57I CTGAAG 1 cut(s) 162
FaeI CATG 1 cut(s) 176
FaiI YATR 4 cut(s) 129, 155, 157, 174
FatI CATG 1 cut(s) 172
FauI CCCGC 1 cut(s) 147
FauNDI CATATG 1 cut(s) 155
GsuI CTGGAG 1 cut(s) 135
Hin1II CATG 1 cut(s) 176
HinfI GANTC 1 cut(s) 61
Hpy188I TCNGA 1 cut(s) 181
Hpy188III TCNNGA 2 cut(s) 98, 134
HpyAV CCTTC 1 cut(s) 133
HpyF3I CTNAG 2 cut(s) 5, 165
Hsp92II CATG 1 cut(s) 176
Kzo9I GATC 1 cut(s) 52
LpnPI CCDG 3 cut(s) 88, 99, 105
MaeIII GTNAC 1 cut(s) 118
MalI GATC 1 cut(s) 54
MboI GATC 1 cut(s) 52
MboII GAAGA 1 cut(s) 18
MfeI CAATTG 1 cut(s) 56
MluCI AATT 3 cut(s) 56, 65, 107
MunI CAATTG 1 cut(s) 56
NdeI CATATG 1 cut(s) 155
NdeII GATC 1 cut(s) 52
NlaIII CATG 1 cut(s) 176
NmuCI GTSAC 1 cut(s) 118
PfeI GAWTC 1 cut(s) 61
Sau3AI GATC 1 cut(s) 52
SetI ASST 1 cut(s) 125
SgeI CNNG 7 cut(s) 31, 104, 110, 115, 126, 146, 151
Sse9I AATT 3 cut(s) 56, 65, 107
SsiI CCGC 1 cut(s) 140
TaqI TCGA 1 cut(s) 99
TasI AATT 3 cut(s) 56, 65, 107
TfiI GAWTC 1 cut(s) 61
TseFI GTSAC 1 cut(s) 118
Tsp45I GTSAC 1 cut(s) 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.