Rh7DG191600
HSP70 Family

Heat shock cognate 70 kDa

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
17817764 .. 17829820
12057 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG191600.1

Sequence Viewer

Length: 243 bp
ATGGAGGCTAAGACTGCGTTGGAAAACTATGCATATGACCAGAGGCGAAGAATTTATAAGCACTCAAATATTGAACCAGAAGTCATGAAGAAAATTGCGGATGAGGTTGGAAAAGTAATTCACTGGCTTGAGAATGATAACCAACCTTTGAGTCTTGAAGAAATTGAGAATAAGATGAAAAAGCTACAAAACGTCTGCAATCCTATATTTGGCGAAGATGTATCAGGGAGTACAATGGAGTAA
Functional Annotation

Protein Analysis

80

Amino Acids

9.34

Weight (kDa)

5.18

Isoelectric Point (pI)

67.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020594)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 57
AciI CCGC 1 cut(s) 98
AcsI RAATTY 1 cut(s) 51
AfaI GTAC 1 cut(s) 232
AfiI CCNNNNNNNGG 1 cut(s) 209
AgsI TTSAA 2 cut(s) 74, 158
AluBI AGCT 1 cut(s) 184
AluI AGCT 1 cut(s) 184
ApoI RAATTY 1 cut(s) 51
BpuEI CTTGAG 1 cut(s) 149
Bsc4I CCNNNNNNNGG 1 cut(s) 209
Bse1I ACTGG 1 cut(s) 128
BseGI GGATG 1 cut(s) 106
BseLI CCNNNNNNNGG 1 cut(s) 209
BseNI ACTGG 1 cut(s) 128
BslI CCNNNNNNNGG 1 cut(s) 209
BspACI CCGC 1 cut(s) 98
BspHI TCATGA 1 cut(s) 84
BsrI ACTGG 1 cut(s) 128
BstDEI CTNAG 1 cut(s) 9
BstF5I GGATG 1 cut(s) 106
BstMWI GCNNNNNNNGC 1 cut(s) 14
BtsCI GGATG 1 cut(s) 106
BtsIMutI CAGTG 1 cut(s) 121
CciI TCATGA 1 cut(s) 84
Csp6I GTAC 1 cut(s) 231
CviAII CATG 1 cut(s) 85
CviJI RGCY 3 cut(s) 8, 127, 184
CviKI_1 RGCY 3 cut(s) 8, 127, 184
CviQI GTAC 1 cut(s) 231
DdeI CTNAG 1 cut(s) 9
EcoT22I ATGCAT 1 cut(s) 34
FaeI CATG 1 cut(s) 88
FaiI YATR 6 cut(s) 30, 34, 36, 57, 86, 206
FatI CATG 1 cut(s) 84
FauNDI CATATG 1 cut(s) 34
FokI GGATG 1 cut(s) 113
Hin1II CATG 1 cut(s) 88
HinfI GANTC 1 cut(s) 151
Hpy188III TCNNGA 2 cut(s) 85, 155
HpyCH4IV ACGT 1 cut(s) 192
HpyCH4V TGCA 2 cut(s) 32, 198
HpyF10VI GCNNNNNNNGC 1 cut(s) 14
HpyF3I CTNAG 1 cut(s) 9
HpySE526I ACGT 1 cut(s) 192
Hsp92II CATG 1 cut(s) 88
LpnPI CCDG 4 cut(s) 53, 90, 109, 210
MaeII ACGT 1 cut(s) 192
MboII GAAGA 4 cut(s) 60, 100, 170, 227
MluCI AATT 4 cut(s) 51, 93, 117, 162
MlyI GAGTC 1 cut(s) 160
MmeI TCCRAC 1 cut(s) 88
MnlI CCTC 2 cut(s) 36, 97
Mph1103I ATGCAT 1 cut(s) 34
MwoI GCNNNNNNNGC 1 cut(s) 14
NdeI CATATG 1 cut(s) 34
NlaIII CATG 1 cut(s) 88
NsiI ATGCAT 1 cut(s) 34
PagI TCATGA 1 cut(s) 84
PleI GAGTC 1 cut(s) 159
PpsI GAGTC 1 cut(s) 159
PsiI TTATAA 1 cut(s) 57
RsaI GTAC 1 cut(s) 232
RsaNI GTAC 1 cut(s) 231
SchI GAGTC 1 cut(s) 160
SetI ASST 4 cut(s) 108, 148, 186, 195
SgeI CNNG 7 cut(s) 52, 89, 97, 136, 140, 167, 237
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
Sse9I AATT 4 cut(s) 51, 93, 117, 162
SsiI CCGC 1 cut(s) 98
SspI AATATT 1 cut(s) 70
TaiI ACGT 1 cut(s) 195
TasI AATT 4 cut(s) 51, 93, 117, 162
TatI WGTACW 1 cut(s) 230
TscAI CASTG 1 cut(s) 128
TspDTI ATGAA 2 cut(s) 101, 191
TspRI CASTG 1 cut(s) 128
XapI RAATTY 1 cut(s) 51
Zsp2I ATGCAT 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.