Rw1G030050

Belongs to the Casparian strip membrane proteins (CASP) family

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Forward (+)
57754360 .. 57757655
3296 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G030050.1

Sequence Viewer

Length: 531 bp
ATGGCCTTCATGCTTTCGCCTGGGGTCTCGCGAATCGTTACTATTGTATTGAGGGTCCTGGCTGCCATTGTTCTGTTTGTATCACTCGTGATGCTCGTCGCCAATAATCAGGATTATCCAGACCCTAGTGACAACGGAAACACTAAAACCGCTCGTTTTTATGATCAAGTTGGATTCCAATACATGGCTGCCACAACAGCTCTCGGAATTGGGTTTTCAATCTATGGAACCGTAGTTGTAGCTTTGCGCATCAAGAGAGGAAATGATGAAGGGAACCTGTTGATTGATTTCTATGGCCAGAAGGTTTTGTCGAATTTATTAGTTACAGGAGCTGTTGCGGGATTTCTTACGGTCCAAGCTGTGGAAAAAGCTCTCTCTGATTACGTGGGCAACACATTCGCGGTGCTGGTCACTAACAACTATTATTGGGGTATGTATAAGACGTGTTCTGGACTTGTCCTCCTTGGCTTCTTCTTGTCTGTTGCACTGTCGATCCTGTCTTCCCATACCCTTGTCAGAAGGAATTATTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

176

Amino Acids

19.16

Weight (kDa)

9.04

Isoelectric Point (pI)

21.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CASP_dom PF04535 11 - 121 2e-11 Casparian strip membrane protein domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017713)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g22230
rosa_chinensis RchiOBHm_Chr1g0366621
rosa_laevigata RLG00000027332
rosa_multiflora Rmu_sc0003180.1_g000008
rosa_roxburghii Rroxscaffold_4G00289810
rosa_rugosa Rorug01G0330900 Rorug01G0331000
rosa_samantha Rh1AG339300 Rh1BG301000 Rh1CG315800 Rh1DG332600
rosa_wichuraiana Rw1G030050

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 248
AccB7I CCANNNNNTGG 2 cut(s) 184, 361
AccBSI CCGCTC 1 cut(s) 152
AccII CGCG 2 cut(s) 31, 401
AciI CCGC 3 cut(s) 150, 338, 401
AclWI GGATC 1 cut(s) 487
AcoI YGGCCR 1 cut(s) 295
AcsI RAATTY 1 cut(s) 313
AfiI CCNNNNNNNGG 2 cut(s) 184, 361
AflIII ACRYGT 1 cut(s) 443
AgsI TTSAA 1 cut(s) 219
AjiI CACGTC 1 cut(s) 444
AjnI CCWGG 2 cut(s) 19, 57
AluBI AGCT 5 cut(s) 200, 242, 332, 359, 371
AluI AGCT 5 cut(s) 200, 242, 332, 359, 371
Alw26I GTCTC 1 cut(s) 31
AlwI GGATC 1 cut(s) 487
AlwNI CAGNNNCTG 1 cut(s) 332
AoxI GGCC 2 cut(s) 3, 295
ApeKI GCWGC 2 cut(s) 62, 188
ApoI RAATTY 1 cut(s) 313
AspLEI GCGC 1 cut(s) 249
AspS9I GGNCC 2 cut(s) 55, 352
AvaII GGWCC 2 cut(s) 55, 352
BalI TGGCCA 1 cut(s) 297
BauI CACGAG 1 cut(s) 86
BbsI GAAGAC 1 cut(s) 492
BbvI GCAGC 2 cut(s) 49, 175
BcgI CGANNNNNNTGC 2 cut(s) 379, 413
BciT130I CCWGG 2 cut(s) 21, 59
BclI TGATCA 1 cut(s) 163
BcoDI GTCTC 1 cut(s) 31
BfaI CTAG 1 cut(s) 126
BisI GCNGC 2 cut(s) 63, 189
BlsI GCNGC 2 cut(s) 64, 190
Bme1390I CCNGG 2 cut(s) 21, 59
Bme18I GGWCC 2 cut(s) 55, 352
BmgBI CACGTC 1 cut(s) 444
BmgT120I GGNCC 2 cut(s) 55, 352
BmiI GGNNCC 3 cut(s) 56, 229, 275
BmrFI CCNGG 2 cut(s) 21, 59
BmsI GCATC 2 cut(s) 81, 258
BpiI GAAGAC 1 cut(s) 492
BsaAI YACGTR 1 cut(s) 385
BsaI GGTCTC 1 cut(s) 31
BsaJI CCNNGG 2 cut(s) 20, 463
BsaXI ACNNNNNCTCC 2 cut(s) 444, 474
Bsc4I CCNNNNNNNGG 2 cut(s) 184, 361
BseBI CCWGG 2 cut(s) 21, 59
BseDI CCNNGG 2 cut(s) 20, 463
BseLI CCNNNNNNNGG 2 cut(s) 184, 361
BseXI GCAGC 2 cut(s) 49, 175
Bsh1236I CGCG 2 cut(s) 31, 401
BshFI GGCC 2 cut(s) 5, 297
BslI CCNNNNNNNGG 2 cut(s) 184, 361
BsmAI GTCTC 1 cut(s) 31
BsnI GGCC 2 cut(s) 5, 297
Bso31I GGTCTC 1 cut(s) 31
Bsp143I GATC 2 cut(s) 163, 492
Bsp68I TCGCGA 1 cut(s) 31
BspACI CCGC 3 cut(s) 150, 338, 401
BspANI GGCC 2 cut(s) 5, 297
BspFNI CGCG 2 cut(s) 31, 401
BspLI GGNNCC 3 cut(s) 56, 229, 275
BspPI GGATC 1 cut(s) 487
BspTNI GGTCTC 1 cut(s) 31
BsrBI CCGCTC 1 cut(s) 152
BssECI CCNNGG 2 cut(s) 20, 463
BssMI GATC 2 cut(s) 163, 492
BssSI CACGAG 1 cut(s) 86
BssT1I CCWWGG 1 cut(s) 463
Bst2BI CACGAG 1 cut(s) 86
Bst2UI CCWGG 2 cut(s) 21, 59
Bst4CI ACNGT 3 cut(s) 232, 352, 489
BstBAI YACGTR 1 cut(s) 385
BstFNI CGCG 2 cut(s) 31, 401
BstHHI GCGC 1 cut(s) 249
BstKTI GATC 2 cut(s) 166, 495
BstMAI GTCTC 1 cut(s) 31
BstMBI GATC 2 cut(s) 163, 492
BstMWI GCNNNNNNNGC 1 cut(s) 197
BstNI CCWGG 2 cut(s) 21, 59
BstSCI CCNGG 2 cut(s) 19, 57
BstUI CGCG 2 cut(s) 31, 401
BstV1I GCAGC 2 cut(s) 49, 175
BstV2I GAAGAC 1 cut(s) 492
BsuRI GGCC 2 cut(s) 5, 297
BtrI CACGTC 1 cut(s) 444
BtsIMutI CAGTG 1 cut(s) 485
BtuMI TCGCGA 1 cut(s) 31
CaiI CAGNNNCTG 1 cut(s) 332
CfoI GCGC 1 cut(s) 249
Cfr13I GGNCC 2 cut(s) 55, 352
CviAII CATG 2 cut(s) 10, 184
DpnI GATC 2 cut(s) 165, 494
DpnII GATC 2 cut(s) 163, 492
EaeI YGGCCR 1 cut(s) 295
Eco130I CCWWGG 1 cut(s) 463
Eco31I GGTCTC 1 cut(s) 31
Eco47I GGWCC 2 cut(s) 55, 352
EcoO109I RGGNCCY 1 cut(s) 55
EcoRII CCWGG 2 cut(s) 19, 57
EcoT14I CCWWGG 1 cut(s) 463
ErhI CCWWGG 1 cut(s) 463
FaeI CATG 2 cut(s) 13, 187
FaiI YATR 8 cut(s) 11, 162, 185, 225, 294, 434, 438, 507
FatI CATG 2 cut(s) 9, 183
FauI CCCGC 1 cut(s) 331
FbaI TGATCA 1 cut(s) 163
Fnu4HI GCNGC 2 cut(s) 63, 189
Fsp4HI GCNGC 2 cut(s) 63, 189
FspBI CTAG 1 cut(s) 126
FspI TGCGCA 1 cut(s) 248
GlaI GCGC 1 cut(s) 248
GluI GCNGC 2 cut(s) 63, 189
HaeIII GGCC 2 cut(s) 5, 297
HhaI GCGC 1 cut(s) 249
Hin1II CATG 2 cut(s) 13, 187
Hin6I GCGC 1 cut(s) 247
HinP1I GCGC 1 cut(s) 247
HinfI GANTC 2 cut(s) 33, 174
Hpy188I TCNGA 3 cut(s) 206, 379, 518
Hpy188III TCNNGA 6 cut(s) 30, 88, 110, 119, 253, 450
Hpy99I CGWCG 1 cut(s) 101
HpyAV CCTTC 4 cut(s) 16, 263, 295, 513
HpyCH4III ACNGT 3 cut(s) 232, 352, 489
HpyCH4IV ACGT 2 cut(s) 384, 443
HpyCH4V TGCA 1 cut(s) 485
HpyF10VI GCNNNNNNNGC 1 cut(s) 197
HpySE526I ACGT 2 cut(s) 384, 443
Hsp92II CATG 2 cut(s) 13, 187
HspAI GCGC 1 cut(s) 247
Ksp22I TGATCA 1 cut(s) 163
Kzo9I GATC 2 cut(s) 163, 492
LmnI GCTCC 1 cut(s) 329
Lsp1109I GCAGC 2 cut(s) 49, 175
LweI GCATC 2 cut(s) 81, 258
MaeI CTAG 1 cut(s) 126
MaeII ACGT 2 cut(s) 384, 443
MaeIII GTNAC 4 cut(s) 37, 128, 322, 409
MalI GATC 2 cut(s) 165, 494
MbiI CCGCTC 1 cut(s) 152
MboI GATC 2 cut(s) 163, 492
MboII GAAGA 2 cut(s) 463, 492
MlsI TGGCCA 1 cut(s) 297
MluCI AATT 3 cut(s) 207, 313, 523
MluNI TGGCCA 1 cut(s) 297
MmeI TCCRAC 1 cut(s) 151
MnlI CCTC 3 cut(s) 45, 251, 470
Mox20I TGGCCA 1 cut(s) 297
MscI TGGCCA 1 cut(s) 297
Msp20I TGGCCA 1 cut(s) 297
MspR9I CCNGG 2 cut(s) 21, 59
MvaI CCWGG 2 cut(s) 21, 59
MvnI CGCG 2 cut(s) 31, 401
MwoI GCNNNNNNNGC 1 cut(s) 197
NdeII GATC 2 cut(s) 163, 492
NlaIII CATG 2 cut(s) 13, 187
NlaIV GGNNCC 3 cut(s) 56, 229, 275
NmuCI GTSAC 2 cut(s) 128, 409
NruI TCGCGA 1 cut(s) 31
NsbI TGCGCA 1 cut(s) 248
PcsI WCGNNNNNNNCGW 1 cut(s) 93
PfeI GAWTC 2 cut(s) 33, 174
PflMI CCANNNNNTGG 2 cut(s) 184, 361
PkrI GCNGC 2 cut(s) 64, 190
Ppu21I YACGTR 1 cut(s) 385
PpuMI RGGWCCY 1 cut(s) 55
Psp5II RGGWCCY 1 cut(s) 55
Psp6I CCWGG 2 cut(s) 19, 57
PspGI CCWGG 2 cut(s) 19, 57
PspN4I GGNNCC 3 cut(s) 56, 229, 275
PspPI GGNCC 2 cut(s) 55, 352
PspPPI RGGWCCY 1 cut(s) 55
PstNI CAGNNNCTG 1 cut(s) 332
RruI TCGCGA 1 cut(s) 31
SatI GCNGC 2 cut(s) 63, 189
Sau3AI GATC 2 cut(s) 163, 492
Sau96I GGNCC 2 cut(s) 55, 352
ScrFI CCNGG 2 cut(s) 21, 59
SetI ASST 9 cut(s) 202, 244, 279, 306, 334, 361, 373, 387, 446
SfaNI GCATC 2 cut(s) 81, 258
SinI GGWCC 2 cut(s) 55, 352
Sse9I AATT 3 cut(s) 207, 313, 523
SsiI CCGC 3 cut(s) 150, 338, 401
SspMI CTAG 1 cut(s) 126
StyD4I CCNGG 2 cut(s) 19, 57
StyI CCWWGG 1 cut(s) 463
TaaI ACNGT 3 cut(s) 232, 352, 489
TaiI ACGT 2 cut(s) 387, 446
TaqI TCGA 2 cut(s) 311, 491
TasI AATT 3 cut(s) 207, 313, 523
TfiI GAWTC 2 cut(s) 33, 174
TscAI CASTG 1 cut(s) 492
TseFI GTSAC 2 cut(s) 128, 409
TseI GCWGC 2 cut(s) 62, 188
Tsp45I GTSAC 2 cut(s) 128, 409
TspDTI ATGAA 1 cut(s) 282
TspGWI ACGGA 1 cut(s) 150
TspRI CASTG 1 cut(s) 492
Van91I CCANNNNNTGG 2 cut(s) 184, 361
VpaK11BI GGWCC 2 cut(s) 55, 352
XapI RAATTY 1 cut(s) 313
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.