AT1G47695

F-Box protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Reverse (-)
17546326 .. 17546545
220 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G47695.1

Sequence Viewer

Length: 192 bp
ATGGAGAAATCGCAATCACCGTCTGATACACGGGGAAGAAGTGTTGTAGTTGATGTAGACAACACTAAAGATCGCATTAGCGATCTCCCAAACGAAATTTTGGGTAAAATCATATTAAAACTTCCTTTAGACGAAACTGTGAGAACTATGGCTCTATCAAAACGATGGAAGAGTATATGGGATGATAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

7.21

Weight (kDa)

6.15

Isoelectric Point (pI)

51.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 26 - 62 9.8e-10 F-box domain
F-box-like PF12937 26 - 62 8.4e-06 F-box-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018767)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G47695
rosa_chinensis RchiOBHm_Chr5g0018111
rosa_laevigata RLG00000032321 RLG00000032322
rosa_multiflora Rmu_sc0010280.1_g000022 Rmu_sc0013814.1_g000004
rosa_roxburghii Rroxscaffold_1G00069250
rosa_samantha Rh5CG143900 Rh5DG133700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 57
AcsI RAATTY 1 cut(s) 96
ApoI RAATTY 1 cut(s) 96
AsuHPI GGTGA 1 cut(s) 9
BccI CCATC 1 cut(s) 159
BseGI GGATG 1 cut(s) 187
Bsp143I GATC 2 cut(s) 70, 82
BssMI GATC 2 cut(s) 70, 82
Bst4CI ACNGT 2 cut(s) 21, 139
Bst6I CTCTTC 1 cut(s) 164
BstF5I GGATG 1 cut(s) 187
BstKTI GATC 2 cut(s) 73, 85
BstMBI GATC 2 cut(s) 70, 82
BtsCI GGATG 1 cut(s) 187
CviJI RGCY 1 cut(s) 152
CviKI_1 RGCY 1 cut(s) 152
DpnI GATC 2 cut(s) 72, 84
DpnII GATC 2 cut(s) 70, 82
Eam1104I CTCTTC 1 cut(s) 164
EarI CTCTTC 1 cut(s) 164
FaiI YATR 4 cut(s) 113, 149, 176, 178
FblI GTMKAC 1 cut(s) 57
HphI GGTGA 1 cut(s) 9
Hpy166II GTNNAC 1 cut(s) 58
Hpy188I TCNGA 1 cut(s) 25
Hpy8I GTNNAC 1 cut(s) 58
HpyCH4III ACNGT 2 cut(s) 21, 139
Kzo9I GATC 2 cut(s) 70, 82
MalI GATC 2 cut(s) 72, 84
MboI GATC 2 cut(s) 70, 82
MboII GAAGA 2 cut(s) 48, 181
MluCI AATT 2 cut(s) 96, 187
MseI TTAA 1 cut(s) 116
NdeII GATC 2 cut(s) 70, 82
PcsI WCGNNNNNNNCGW 1 cut(s) 17
SaqAI TTAA 1 cut(s) 116
Sau3AI GATC 2 cut(s) 70, 82
SgeI CNNG 2 cut(s) 42, 44
Sse9I AATT 2 cut(s) 96, 187
TaaI ACNGT 2 cut(s) 21, 139
TasI AATT 2 cut(s) 96, 187
Tru1I TTAA 1 cut(s) 116
Tru9I TTAA 1 cut(s) 116
XapI RAATTY 1 cut(s) 96
XmiI GTMKAC 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.