AT1G74055

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
27849230 .. 27849820
591 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G74055.1

Sequence Viewer

Length: 435 bp
ATGGCTATGGCTAGTAGTAGTAGCAGCTCGTCATTGTTTCCTATCCAACAACAACCTCAACAACAATTAGGAGGCAATGAGATCACACCTATGGCTACCAATGCCAATCTAATCGCAGCACCAAACGCTCCAAACCATTACTCTTCCAGCTCCATTGGACCCTTCTTCGCTGTCATATCTGTTCTCATCATTCTTGCTGTTCTCTCCTGCTTCTTGGGTCGATTCTGCGCACGGAGCCGCCAGAGAACTGGTCTAGTGGCTGAAGTCAATCCGTTGGAGATGATAAAGAGTGGTGGGCTTTTAGGTTGGCTGAGACGAAAATGGAGACGGTGTTTGGCCGGAGATGTTGAGGCCGGAGCTAAAGTTGCTGATTGTGCTAGCAAAGAAACACCTAAAGATAATGATCAAATTCGTCTAGAAGCACCTCCAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

144

Amino Acids

15.38

Weight (kDa)

9.13

Isoelectric Point (pI)

64.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016706)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G74055
malus_domestica MD14G1219300.v1.1
prunus_persica Prupe.5G214000_v2.0.a1
pyrus_communis pycom06g18650 pycom14g18170
rosa_chinensis RchiOBHm_Chr7g0184281
rosa_laevigata RLG00000004990
rosa_multiflora Rmu_co8406705.1_g000001
rosa_roxburghii Rroxscaffold_3G00269770
rosa_samantha Rh7AG081500 Rh7BG065800 Rh7CG066100 Rh7DG065800
rosa_wichuraiana Rw7G005390

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 229
AciI CCGC 1 cut(s) 238
AcoI YGGCCR 1 cut(s) 336
AcsI RAATTY 1 cut(s) 408
AcuI CTGAAG 1 cut(s) 282
AluBI AGCT 4 cut(s) 27, 150, 359, 431
AluI AGCT 4 cut(s) 27, 150, 359, 431
Alw26I GTCTC 2 cut(s) 307, 319
AoxI GGCC 2 cut(s) 336, 351
ApeKI GCWGC 2 cut(s) 24, 116
ApoI RAATTY 1 cut(s) 408
AspLEI GCGC 1 cut(s) 230
AspS9I GGNCC 1 cut(s) 158
AsuNHI GCTAGC 1 cut(s) 377
AvaII GGWCC 1 cut(s) 158
BbvI GCAGC 2 cut(s) 36, 128
BclI TGATCA 1 cut(s) 403
BcoDI GTCTC 2 cut(s) 307, 319
BfaI CTAG 4 cut(s) 12, 254, 378, 416
BisI GCNGC 3 cut(s) 25, 117, 238
BlsI GCNGC 3 cut(s) 26, 118, 239
Bme18I GGWCC 1 cut(s) 158
BmgT120I GGNCC 1 cut(s) 158
BmiI GGNNCC 2 cut(s) 160, 236
BmtI GCTAGC 1 cut(s) 381
BpmI CTGGAG 1 cut(s) 411
BsaBI GATNNNNATC 1 cut(s) 402
BsaXI ACNNNNNCTCC 4 cut(s) 316, 346, 348, 378
Bse1I ACTGG 1 cut(s) 253
Bse3DI GCAATG 1 cut(s) 82
Bse8I GATNNNNATC 1 cut(s) 402
BseJI GATNNNNATC 1 cut(s) 402
BseMI GCAATG 1 cut(s) 82
BseMII CTCAG 1 cut(s) 302
BseNI ACTGG 1 cut(s) 253
BseXI GCAGC 2 cut(s) 36, 128
BshFI GGCC 2 cut(s) 338, 353
BsiSI CCGG 2 cut(s) 339, 354
BsmAI GTCTC 2 cut(s) 307, 319
BsmBI CGTCTC 2 cut(s) 307, 319
BsnI GGCC 2 cut(s) 338, 353
Bsp143I GATC 2 cut(s) 81, 403
BspACI CCGC 1 cut(s) 238
BspANI GGCC 2 cut(s) 338, 353
BspCNI CTCAG 1 cut(s) 303
BspLI GGNNCC 2 cut(s) 160, 236
BspOI GCTAGC 1 cut(s) 381
BsrDI GCAATG 1 cut(s) 82
BsrI ACTGG 1 cut(s) 253
BssMI GATC 2 cut(s) 81, 403
Bst4CI ACNGT 1 cut(s) 330
Bst6I CTCTTC 1 cut(s) 148
BstC8I GCNNGC 1 cut(s) 379
BstDEI CTNAG 1 cut(s) 311
BstHHI GCGC 1 cut(s) 230
BstKTI GATC 2 cut(s) 84, 406
BstMAI GTCTC 2 cut(s) 307, 319
BstMBI GATC 2 cut(s) 81, 403
BstMWI GCNNNNNNNGC 6 cut(s) 101, 125, 234, 365, 374, 428
BstV1I GCAGC 2 cut(s) 36, 128
BstXI CCANNNNNNTGG 1 cut(s) 248
BsuRI GGCC 2 cut(s) 338, 353
Cac8I GCNNGC 1 cut(s) 379
CfoI GCGC 1 cut(s) 230
Cfr13I GGNCC 1 cut(s) 158
DdeI CTNAG 1 cut(s) 311
DpnI GATC 2 cut(s) 83, 405
DpnII GATC 2 cut(s) 81, 403
EaeI YGGCCR 1 cut(s) 336
Eam1104I CTCTTC 1 cut(s) 148
EarI CTCTTC 1 cut(s) 148
Eco47I GGWCC 1 cut(s) 158
Eco57I CTGAAG 1 cut(s) 282
Esp3I CGTCTC 2 cut(s) 307, 319
FaiI YATR 3 cut(s) 8, 92, 176
FbaI TGATCA 1 cut(s) 403
Fnu4HI GCNGC 3 cut(s) 25, 117, 238
Fsp4HI GCNGC 3 cut(s) 25, 117, 238
FspBI CTAG 4 cut(s) 12, 254, 378, 416
FspI TGCGCA 1 cut(s) 229
GlaI GCGC 1 cut(s) 229
GluI GCNGC 3 cut(s) 25, 117, 238
GsuI CTGGAG 1 cut(s) 411
HaeIII GGCC 2 cut(s) 338, 353
HapII CCGG 2 cut(s) 339, 354
HhaI GCGC 1 cut(s) 230
Hin6I GCGC 1 cut(s) 228
HinP1I GCGC 1 cut(s) 228
HinfI GANTC 1 cut(s) 222
HpaII CCGG 2 cut(s) 339, 354
Hpy188III TCNNGA 1 cut(s) 416
HpyAV CCTTC 1 cut(s) 172
HpyCH4III ACNGT 1 cut(s) 330
HpyF10VI GCNNNNNNNGC 6 cut(s) 101, 125, 234, 365, 374, 428
HpyF3I CTNAG 1 cut(s) 311
HspAI GCGC 1 cut(s) 228
Ksp22I TGATCA 1 cut(s) 403
Kzo9I GATC 2 cut(s) 81, 403
LmnI GCTCC 4 cut(s) 133, 155, 234, 356
LpnPI CCDG 6 cut(s) 160, 220, 234, 254, 352, 367
Lsp1109I GCAGC 2 cut(s) 36, 128
MaeI CTAG 4 cut(s) 12, 254, 378, 416
MalI GATC 2 cut(s) 83, 405
MboI GATC 2 cut(s) 81, 403
MboII GAAGA 2 cut(s) 135, 157
MluCI AATT 2 cut(s) 65, 408
MmeI TCCRAC 2 cut(s) 70, 255
MnlI CCTC 4 cut(s) 65, 66, 343, 435
MslI CAYNNNNRTG 1 cut(s) 89
MspI CCGG 2 cut(s) 339, 354
MwoI GCNNNNNNNGC 6 cut(s) 101, 125, 234, 365, 374, 428
NdeII GATC 2 cut(s) 81, 403
NheI GCTAGC 1 cut(s) 377
NlaIV GGNNCC 2 cut(s) 160, 236
NsbI TGCGCA 1 cut(s) 229
PfeI GAWTC 1 cut(s) 222
PkrI GCNGC 3 cut(s) 26, 118, 239
PspN4I GGNNCC 2 cut(s) 160, 236
PspPI GGNCC 1 cut(s) 158
RseI CAYNNNNRTG 1 cut(s) 89
SatI GCNGC 3 cut(s) 25, 117, 238
Sau3AI GATC 2 cut(s) 81, 403
Sau96I GGNCC 1 cut(s) 158
SetI ASST 9 cut(s) 29, 58, 91, 152, 307, 361, 394, 427, 433
SinI GGWCC 1 cut(s) 158
SmiMI CAYNNNNRTG 1 cut(s) 89
Sse9I AATT 2 cut(s) 65, 408
SsiI CCGC 1 cut(s) 238
SspMI CTAG 4 cut(s) 12, 254, 378, 416
TaaI ACNGT 1 cut(s) 330
TaqI TCGA 1 cut(s) 220
TasI AATT 2 cut(s) 65, 408
TauI GCSGC 1 cut(s) 240
TfiI GAWTC 1 cut(s) 222
TseI GCWGC 2 cut(s) 24, 116
TspGWI ACGGA 2 cut(s) 247, 261
VpaK11BI GGWCC 1 cut(s) 158
XapI RAATTY 1 cut(s) 408
XbaI TCTAGA 1 cut(s) 415
XspI CTAG 4 cut(s) 12, 254, 378, 416
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.