Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr1

Orthogroup ID

OG0016706

Physical Location & Seq

Genomic Coordinates Reverse (-)

64224129 .. 64224527

Gene Structure 399 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000004990

Sequence Viewer

CDS Protein Promoter (2k)

Length: 399 bp

ATGGCAACAACACCACAAACACTGCCTAATTATCAGCCAGCAGGAGAGAGCTTGAGTACTAATCCGATTCCTGAAGCAGTTCCGATCAGTTCTTCCGGATCAATTGGCCCTTTCTTTGCGGTGGTCTCCGTCTTAACCATCCTTGCATTTCTTTCATGCTTGTTGGGTCGAATTTTGACCCGGGATCAGGTGGTGCTGACACCATTGGAGGGCATTAGAGATCAAAGAAGCTGTCTCACATGGCTGAAGCACAAGTGCAGGTTTTGGTGTGTATCTGGCGATCATTGTCCTCATCCTGATGTGGAAGTTGGATCAGCAAAGGTTAAGGGTTTTGGCCAACGAGGAAATGATATTGTCAAGGTTAAAGAAGGTGATGAGGTTCCTCCCCAAGAGGGTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

133

Amino Acids

14.24

Weight (kDa)

6.27

Isoelectric Point (pI)

37.78

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016706)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G74055
malus_domestica	MD14G1219300.v1.1
prunus_persica	Prupe.5G214000_v2.0.a1
pyrus_communis	pycom06g18650 pycom14g18170
rosa_chinensis	RchiOBHm_Chr7g0184281
rosa_laevigata	RLG00000004990
rosa_multiflora	Rmu_co8406705.1_g000001
rosa_roxburghii	Rroxscaffold_3G00269770
rosa_samantha	Rh7AG081500 Rh7BG065800 Rh7CG066100 Rh7DG065800
rosa_wichuraiana	Rw7G005390

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	249
AccIII	TCCGGA	1 cut(s)	95
AciI	CCGC	1 cut(s)	119
AclWI	GGATC	3 cut(s)	106, 192, 319
AcoI	YGGCCR	1 cut(s)	334
AcsI	RAATTY	1 cut(s)	171
AcuI	CTGAAG	2 cut(s)	93, 266
AfaI	GTAC	1 cut(s)	58
AfiI	CCNNNNNNNGG	3 cut(s)	187, 209, 392
AluBI	AGCT	2 cut(s)	51, 231
AluI	AGCT	2 cut(s)	51, 231
Alw26I	GTCTC	2 cut(s)	130, 239
AlwI	GGATC	3 cut(s)	106, 192, 319
Ama87I	CYCGRG	1 cut(s)	180
Aor13HI	TCCGGA	1 cut(s)	95
AoxI	GGCC	2 cut(s)	106, 334
ApoI	RAATTY	1 cut(s)	171
ArsI	GACNNNNNNTTYG	2 cut(s)	217, 249
Asp700I	GAANNNNTTC	1 cut(s)	78
AspS9I	GGNCC	1 cut(s)	107
AsuC2I	CCSGG	2 cut(s)	181, 182
AsuHPI	GGTGA	1 cut(s)	383
AvaI	CYCGRG	1 cut(s)	180
BalI	TGGCCA	1 cut(s)	336
BccI	CCATC	1 cut(s)	146
BcnI	CCSGG	2 cut(s)	181, 182
BcoDI	GTCTC	2 cut(s)	130, 239
BfuAI	ACCTGC	1 cut(s)	249
BmcAI	AGTACT	1 cut(s)	58
Bme1390I	CCNGG	2 cut(s)	181, 182
BmeT110I	CYCGRG	1 cut(s)	180
BmgT120I	GGNCC	1 cut(s)	107
BmiI	GGNNCC	1 cut(s)	381
BmrFI	CCNGG	2 cut(s)	181, 182
BpuEI	CTTGAG	1 cut(s)	73
BpuMI	CCSGG	2 cut(s)	181, 182
BsaI	GGTCTC	1 cut(s)	130
BsaJI	CCNNGG	1 cut(s)	180
BsaWI	WCCGGW	1 cut(s)	95
Bsc4I	CCNNNNNNNGG	3 cut(s)	187, 209, 392
BseAI	TCCGGA	1 cut(s)	95
BseDI	CCNNGG	1 cut(s)	180
BseGI	GGATG	2 cut(s)	138, 292
BseLI	CCNNNNNNNGG	3 cut(s)	187, 209, 392
BsgI	GTGCAG	1 cut(s)	277
BshFI	GGCC	2 cut(s)	108, 336
BsiHKCI	CYCGRG	1 cut(s)	180
BsiSI	CCGG	2 cut(s)	96, 181
BslI	CCNNNNNNNGG	3 cut(s)	187, 209, 392
BsmAI	GTCTC	2 cut(s)	130, 239
BsnI	GGCC	2 cut(s)	108, 336
Bso31I	GGTCTC	1 cut(s)	130
BsoBI	CYCGRG	1 cut(s)	180
Bsp13I	TCCGGA	1 cut(s)	95
Bsp143I	GATC	6 cut(s)	84, 98, 184, 220, 280, 311
BspACI	CCGC	1 cut(s)	119
BspANI	GGCC	2 cut(s)	108, 336
BspEI	TCCGGA	1 cut(s)	95
BspLI	GGNNCC	1 cut(s)	381
BspMI	ACCTGC	1 cut(s)	249
BspPI	GGATC	3 cut(s)	106, 192, 319
BspTNI	GGTCTC	1 cut(s)	130
BssECI	CCNNGG	1 cut(s)	180
BssMI	GATC	6 cut(s)	84, 98, 184, 220, 280, 311
BstC8I	GCNNGC	1 cut(s)	39
BstF5I	GGATG	2 cut(s)	138, 292
BstKTI	GATC	6 cut(s)	87, 101, 187, 223, 283, 314
BstMAI	GTCTC	2 cut(s)	130, 239
BstMBI	GATC	6 cut(s)	84, 98, 184, 220, 280, 311
BstSCI	CCNGG	2 cut(s)	179, 180
BsuRI	GGCC	2 cut(s)	108, 336
BtsCI	GGATG	2 cut(s)	138, 292
BtsI	GCAGTG	1 cut(s)	20
BtsIMutI	CAGTG	1 cut(s)	20
BveI	ACCTGC	1 cut(s)	249
Cac8I	GCNNGC	1 cut(s)	39
Cfr13I	GGNCC	1 cut(s)	107
Cfr9I	CCCGGG	1 cut(s)	180
Csp6I	GTAC	1 cut(s)	57
CviAII	CATG	2 cut(s)	156, 240
CviJI	RGCY	6 cut(s)	37, 51, 108, 231, 244, 336
CviKI_1	RGCY	6 cut(s)	37, 51, 108, 231, 244, 336
CviQI	GTAC	1 cut(s)	57
DpnI	GATC	6 cut(s)	86, 100, 186, 222, 282, 313
DpnII	GATC	6 cut(s)	84, 98, 184, 220, 280, 311
EaeI	YGGCCR	1 cut(s)	334
Eco31I	GGTCTC	1 cut(s)	130
Eco57I	CTGAAG	2 cut(s)	93, 266
Eco88I	CYCGRG	1 cut(s)	180
FaeI	CATG	2 cut(s)	159, 243
FaiI	YATR	2 cut(s)	157, 241
FatI	CATG	2 cut(s)	155, 239
FokI	GGATG	2 cut(s)	125, 279
HaeIII	GGCC	2 cut(s)	108, 336
HapII	CCGG	2 cut(s)	96, 181
Hin1II	CATG	2 cut(s)	159, 243
HinfI	GANTC	1 cut(s)	67
HpaII	CCGG	2 cut(s)	96, 181
HphI	GGTGA	1 cut(s)	383
Hpy188I	TCNGA	2 cut(s)	66, 84
Hpy188III	TCNNGA	3 cut(s)	71, 96, 296
HpyAV	CCTTC	1 cut(s)	362
HpyCH4V	TGCA	2 cut(s)	146, 258
Hsp92II	CATG	2 cut(s)	159, 243
Kpn2I	TCCGGA	1 cut(s)	95
Kzo9I	GATC	6 cut(s)	84, 98, 184, 220, 280, 311
LpnPI	CCDG	9 cut(s)	27, 51, 84, 109, 173, 194, 244, 261, 309
MalI	GATC	6 cut(s)	86, 100, 186, 222, 282, 313
MboI	GATC	6 cut(s)	84, 98, 184, 220, 280, 311
MboII	GAAGA	1 cut(s)	84
MfeI	CAATTG	1 cut(s)	102
MlsI	TGGCCA	1 cut(s)	336
MluCI	AATT	3 cut(s)	28, 102, 171
MluNI	TGGCCA	1 cut(s)	336
MmeI	TCCRAC	1 cut(s)	289
MnlI	CCTC	6 cut(s)	202, 300, 335, 370, 385, 393
Mox20I	TGGCCA	1 cut(s)	336
MroI	TCCGGA	1 cut(s)	95
MroXI	GAANNNNTTC	1 cut(s)	78
MscI	TGGCCA	1 cut(s)	336
MseI	TTAA	4 cut(s)	134, 324, 363, 397
MslI	CAYNNNNRTG	1 cut(s)	297
Msp20I	TGGCCA	1 cut(s)	336
MspI	CCGG	2 cut(s)	96, 181
MspR9I	CCNGG	2 cut(s)	181, 182
MunI	CAATTG	1 cut(s)	102
NciI	CCSGG	2 cut(s)	181, 182
NdeII	GATC	6 cut(s)	84, 98, 184, 220, 280, 311
NlaIII	CATG	2 cut(s)	159, 243
NlaIV	GGNNCC	1 cut(s)	381
PdmI	GAANNNNTTC	1 cut(s)	78
PfeI	GAWTC	1 cut(s)	67
PspN4I	GGNNCC	1 cut(s)	381
PspPI	GGNCC	1 cut(s)	107
RsaI	GTAC	1 cut(s)	58
RsaNI	GTAC	1 cut(s)	57
RseI	CAYNNNNRTG	1 cut(s)	297
SaqAI	TTAA	4 cut(s)	134, 324, 363, 397
Sau3AI	GATC	6 cut(s)	84, 98, 184, 220, 280, 311
Sau96I	GGNCC	1 cut(s)	107
ScaI	AGTACT	1 cut(s)	58
ScrFI	CCNGG	2 cut(s)	181, 182
SetI	ASST	8 cut(s)	53, 192, 233, 263, 324, 363, 373, 381
SmaI	CCCGGG	1 cut(s)	182
SmiMI	CAYNNNNRTG	1 cut(s)	297
SmlI	CTYRAG	1 cut(s)	52
SmoI	CTYRAG	1 cut(s)	52
Sse9I	AATT	3 cut(s)	28, 102, 171
SsiI	CCGC	1 cut(s)	119
StyD4I	CCNGG	2 cut(s)	179, 180
TaqI	TCGA	1 cut(s)	169
TasI	AATT	3 cut(s)	28, 102, 171
TatI	WGTACW	1 cut(s)	56
TfiI	GAWTC	1 cut(s)	67
Tru1I	TTAA	4 cut(s)	134, 324, 363, 397
Tru9I	TTAA	4 cut(s)	134, 324, 363, 397
TscAI	CASTG	1 cut(s)	27
TspDTI	ATGAA	1 cut(s)	144
TspGWI	ACGGA	1 cut(s)	118
TspMI	CCCGGG	1 cut(s)	180
TspRI	CASTG	1 cut(s)	27
XapI	RAATTY	1 cut(s)	171
XmaI	CCCGGG	1 cut(s)	180
XmnI	GAANNNNTTC	1 cut(s)	78
ZrmI	AGTACT	1 cut(s)	58

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.