Rmu_co8406705.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8406705.1
Physical Location & Seq
Reverse (-)
478 .. 876
399 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8406705.1_g000001.1.cds

Sequence Viewer

Length: 399 bp
atggcaacaacaccacaaacactgcctaattatcagccagcaggagagagcttgagtactaatccgattcctgaagcagttccgatcagttcttctggatcaattggccctttctttgcggtgatctccgtcttaaccatccttgcatttctttcatgcttgttgggtcgaattttgacccgggatcaggtggtgctgacaccattggagggcattagagatcaaagaagctgtctcacatggctgaagcacaagtgcaggttttggtgtgtatctggcgatcattgtcctcatcctgatctggaagttggatcagcaaaggttaagggttttggccaacgaggaaatgatattgccaaggttaaagaaggtgatgaggttcctccccaagagggttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

132

Amino Acids

14.24

Weight (kDa)

6.27

Isoelectric Point (pI)

38.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016706)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G74055
malus_domestica MD14G1219300.v1.1
prunus_persica Prupe.5G214000_v2.0.a1
pyrus_communis pycom06g18650 pycom14g18170
rosa_chinensis RchiOBHm_Chr7g0184281
rosa_laevigata RLG00000004990
rosa_multiflora Rmu_co8406705.1_g000001
rosa_roxburghii Rroxscaffold_3G00269770
rosa_samantha Rh7AG081500 Rh7BG065800 Rh7CG066100 Rh7DG065800
rosa_wichuraiana Rw7G005390

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 249
AciI CCGC 1 cut(s) 119
AclWI GGATC 3 cut(s) 106, 192, 319
AcoI YGGCCR 1 cut(s) 334
AcsI RAATTY 1 cut(s) 171
AcuI CTGAAG 2 cut(s) 93, 266
AfaI GTAC 1 cut(s) 58
AfiI CCNNNNNNNGG 3 cut(s) 187, 209, 392
AluBI AGCT 2 cut(s) 51, 231
AluI AGCT 2 cut(s) 51, 231
Alw26I GTCTC 1 cut(s) 239
AlwI GGATC 3 cut(s) 106, 192, 319
Ama87I CYCGRG 1 cut(s) 180
AoxI GGCC 2 cut(s) 106, 334
ApoI RAATTY 1 cut(s) 171
ArsI GACNNNNNNTTYG 2 cut(s) 217, 249
Asp700I GAANNNNTTC 1 cut(s) 78
AspS9I GGNCC 1 cut(s) 107
AsuC2I CCSGG 2 cut(s) 181, 182
AsuHPI GGTGA 2 cut(s) 133, 383
AvaI CYCGRG 1 cut(s) 180
BalI TGGCCA 1 cut(s) 336
BccI CCATC 1 cut(s) 146
BcnI CCSGG 2 cut(s) 181, 182
BcoDI GTCTC 1 cut(s) 239
BfuAI ACCTGC 1 cut(s) 249
BmcAI AGTACT 1 cut(s) 58
Bme1390I CCNGG 2 cut(s) 181, 182
BmeT110I CYCGRG 1 cut(s) 180
BmgT120I GGNCC 1 cut(s) 107
BmiI GGNNCC 1 cut(s) 381
BmrFI CCNGG 2 cut(s) 181, 182
BpuEI CTTGAG 1 cut(s) 73
BpuMI CCSGG 2 cut(s) 181, 182
BsaJI CCNNGG 2 cut(s) 180, 357
Bsc4I CCNNNNNNNGG 3 cut(s) 187, 209, 392
BseDI CCNNGG 2 cut(s) 180, 357
BseGI GGATG 2 cut(s) 138, 292
BseLI CCNNNNNNNGG 3 cut(s) 187, 209, 392
BsgI GTGCAG 1 cut(s) 277
BshFI GGCC 2 cut(s) 108, 336
BsiHKCI CYCGRG 1 cut(s) 180
BsiSI CCGG 1 cut(s) 181
BslI CCNNNNNNNGG 3 cut(s) 187, 209, 392
BsmAI GTCTC 1 cut(s) 239
BsnI GGCC 2 cut(s) 108, 336
BsoBI CYCGRG 1 cut(s) 180
Bsp143I GATC 8 cut(s) 84, 98, 123, 184, 220, 280, 298, 311
BspACI CCGC 1 cut(s) 119
BspANI GGCC 2 cut(s) 108, 336
BspLI GGNNCC 1 cut(s) 381
BspMI ACCTGC 1 cut(s) 249
BspPI GGATC 3 cut(s) 106, 192, 319
BssECI CCNNGG 2 cut(s) 180, 357
BssMI GATC 8 cut(s) 84, 98, 123, 184, 220, 280, 298, 311
BssT1I CCWWGG 1 cut(s) 357
BstC8I GCNNGC 1 cut(s) 39
BstF5I GGATG 2 cut(s) 138, 292
BstKTI GATC 8 cut(s) 87, 101, 126, 187, 223, 283, 301, 314
BstMAI GTCTC 1 cut(s) 239
BstMBI GATC 8 cut(s) 84, 98, 123, 184, 220, 280, 298, 311
BstSCI CCNGG 2 cut(s) 179, 180
BsuRI GGCC 2 cut(s) 108, 336
BtsCI GGATG 2 cut(s) 138, 292
BtsI GCAGTG 1 cut(s) 20
BtsIMutI CAGTG 1 cut(s) 20
BveI ACCTGC 1 cut(s) 249
Cac8I GCNNGC 1 cut(s) 39
Cfr13I GGNCC 1 cut(s) 107
Cfr9I CCCGGG 1 cut(s) 180
Csp6I GTAC 1 cut(s) 57
CviAII CATG 2 cut(s) 156, 240
CviJI RGCY 6 cut(s) 37, 51, 108, 231, 244, 336
CviKI_1 RGCY 6 cut(s) 37, 51, 108, 231, 244, 336
CviQI GTAC 1 cut(s) 57
DpnI GATC 8 cut(s) 86, 100, 125, 186, 222, 282, 300, 313
DpnII GATC 8 cut(s) 84, 98, 123, 184, 220, 280, 298, 311
EaeI YGGCCR 1 cut(s) 334
Eco130I CCWWGG 1 cut(s) 357
Eco57I CTGAAG 2 cut(s) 93, 266
Eco88I CYCGRG 1 cut(s) 180
EcoT14I CCWWGG 1 cut(s) 357
ErhI CCWWGG 1 cut(s) 357
FaeI CATG 2 cut(s) 159, 243
FaiI YATR 2 cut(s) 157, 241
FatI CATG 2 cut(s) 155, 239
FokI GGATG 2 cut(s) 125, 279
HaeIII GGCC 2 cut(s) 108, 336
HapII CCGG 1 cut(s) 181
Hin1II CATG 2 cut(s) 159, 243
HinfI GANTC 1 cut(s) 67
HpaII CCGG 1 cut(s) 181
HphI GGTGA 2 cut(s) 133, 383
Hpy188I TCNGA 2 cut(s) 66, 84
Hpy188III TCNNGA 4 cut(s) 71, 96, 296, 302
HpyAV CCTTC 1 cut(s) 362
HpyCH4V TGCA 2 cut(s) 146, 258
Hsp92II CATG 2 cut(s) 159, 243
Kzo9I GATC 8 cut(s) 84, 98, 123, 184, 220, 280, 298, 311
MalI GATC 8 cut(s) 86, 100, 125, 186, 222, 282, 300, 313
MboI GATC 8 cut(s) 84, 98, 123, 184, 220, 280, 298, 311
MboII GAAGA 1 cut(s) 84
MfeI CAATTG 1 cut(s) 102
MlsI TGGCCA 1 cut(s) 336
MluCI AATT 3 cut(s) 28, 102, 171
MluNI TGGCCA 1 cut(s) 336
MmeI TCCRAC 1 cut(s) 289
MnlI CCTC 6 cut(s) 202, 300, 335, 370, 385, 393
Mox20I TGGCCA 1 cut(s) 336
MroXI GAANNNNTTC 1 cut(s) 78
MscI TGGCCA 1 cut(s) 336
MseI TTAA 4 cut(s) 134, 324, 363, 397
Msp20I TGGCCA 1 cut(s) 336
MspI CCGG 1 cut(s) 181
MspR9I CCNGG 2 cut(s) 181, 182
MunI CAATTG 1 cut(s) 102
NciI CCSGG 2 cut(s) 181, 182
NdeII GATC 8 cut(s) 84, 98, 123, 184, 220, 280, 298, 311
NlaIII CATG 2 cut(s) 159, 243
NlaIV GGNNCC 1 cut(s) 381
PdmI GAANNNNTTC 1 cut(s) 78
PfeI GAWTC 1 cut(s) 67
PspN4I GGNNCC 1 cut(s) 381
PspPI GGNCC 1 cut(s) 107
RsaI GTAC 1 cut(s) 58
RsaNI GTAC 1 cut(s) 57
SaqAI TTAA 4 cut(s) 134, 324, 363, 397
Sau3AI GATC 8 cut(s) 84, 98, 123, 184, 220, 280, 298, 311
Sau96I GGNCC 1 cut(s) 107
ScaI AGTACT 1 cut(s) 58
ScrFI CCNGG 2 cut(s) 181, 182
SetI ASST 8 cut(s) 53, 192, 233, 263, 324, 363, 373, 381
SmaI CCCGGG 1 cut(s) 182
SmlI CTYRAG 1 cut(s) 52
SmoI CTYRAG 1 cut(s) 52
Sse9I AATT 3 cut(s) 28, 102, 171
SsiI CCGC 1 cut(s) 119
StyD4I CCNGG 2 cut(s) 179, 180
StyI CCWWGG 1 cut(s) 357
TaqI TCGA 1 cut(s) 169
TasI AATT 3 cut(s) 28, 102, 171
TatI WGTACW 1 cut(s) 56
TfiI GAWTC 1 cut(s) 67
Tru1I TTAA 4 cut(s) 134, 324, 363, 397
Tru9I TTAA 4 cut(s) 134, 324, 363, 397
TscAI CASTG 1 cut(s) 27
TspDTI ATGAA 1 cut(s) 144
TspGWI ACGGA 1 cut(s) 118
TspMI CCCGGG 1 cut(s) 180
TspRI CASTG 1 cut(s) 27
XapI RAATTY 1 cut(s) 171
XmaI CCCGGG 1 cut(s) 180
XmnI GAANNNNTTC 1 cut(s) 78
ZrmI AGTACT 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.