AT2G16385

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Forward (+)
7094743 .. 7095824
1082 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G16385.1

Sequence Viewer

Length: 252 bp
ATGGGTATGTCACCATTAACGGTGAAGAAACTTGGTTTCATCTTCATGATTGTTTCAGCTTCTGCTCTTTCTGTCTCCTTTGCAGGCCGACCATCGATTTTTGTTCATAAAAAAATAAATCTTCGCGAAGAGATGGTGGAAAGAAGCATGCATGAGCATGAGAGGCTTCTAAGAATGAACACAAAGGATTATGGGAACAACAGTCCGTCACCTAGACTTGAGAGACCTCCTTTCAAGCTTATACCCAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

9.51

Weight (kDa)

10.35

Isoelectric Point (pI)

57.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013349)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 126
AgsI TTSAA 1 cut(s) 235
AluBI AGCT 2 cut(s) 59, 238
AluI AGCT 2 cut(s) 59, 238
Alw26I GTCTC 2 cut(s) 79, 217
AlwNI CAGNNNCTG 1 cut(s) 62
AoxI GGCC 1 cut(s) 85
AsuHPI GGTGA 3 cut(s) 3, 34, 201
BccI CCATC 2 cut(s) 100, 127
BcoDI GTCTC 2 cut(s) 79, 217
BfaI CTAG 1 cut(s) 213
BpuEI CTTGAG 1 cut(s) 239
Bsa29I ATCGAT 1 cut(s) 95
BsaI GGTCTC 1 cut(s) 217
BseCI ATCGAT 1 cut(s) 95
Bsh1236I CGCG 1 cut(s) 126
BshFI GGCC 1 cut(s) 87
BshVI ATCGAT 1 cut(s) 95
BsmAI GTCTC 2 cut(s) 79, 217
BsnI GGCC 1 cut(s) 87
Bso31I GGTCTC 1 cut(s) 217
Bsp68I TCGCGA 1 cut(s) 126
BspANI GGCC 1 cut(s) 87
BspDI ATCGAT 1 cut(s) 95
BspFNI CGCG 1 cut(s) 126
BspHI TCATGA 1 cut(s) 45
BspTNI GGTCTC 1 cut(s) 217
Bst4CI ACNGT 2 cut(s) 22, 203
Bst6I CTCTTC 1 cut(s) 123
BstC8I GCNNGC 2 cut(s) 85, 149
BstDEI CTNAG 1 cut(s) 170
BstFNI CGCG 1 cut(s) 126
BstMAI GTCTC 2 cut(s) 79, 217
BstMWI GCNNNNNNNGC 1 cut(s) 163
BstNSI RCATGY 1 cut(s) 151
BstUI CGCG 1 cut(s) 126
Bsu15I ATCGAT 1 cut(s) 95
BsuRI GGCC 1 cut(s) 87
BsuTUI ATCGAT 1 cut(s) 95
BtuMI TCGCGA 1 cut(s) 126
Cac8I GCNNGC 2 cut(s) 85, 149
CaiI CAGNNNCTG 1 cut(s) 62
CciI TCATGA 1 cut(s) 45
ClaI ATCGAT 1 cut(s) 95
CviAII CATG 4 cut(s) 46, 148, 152, 158
CviJI RGCY 4 cut(s) 59, 87, 166, 238
CviKI_1 RGCY 4 cut(s) 59, 87, 166, 238
DdeI CTNAG 1 cut(s) 170
Eam1104I CTCTTC 1 cut(s) 123
EarI CTCTTC 1 cut(s) 123
Eco31I GGTCTC 1 cut(s) 217
EcoT22I ATGCAT 1 cut(s) 153
FaeI CATG 4 cut(s) 49, 151, 155, 161
FaiI YATR 8 cut(s) 8, 47, 108, 149, 153, 159, 192, 242
FatI CATG 4 cut(s) 45, 147, 151, 157
FspBI CTAG 1 cut(s) 213
HaeIII GGCC 1 cut(s) 87
Hin1II CATG 4 cut(s) 49, 151, 155, 161
HindIII AAGCTT 1 cut(s) 236
HphI GGTGA 3 cut(s) 3, 34, 201
Hpy188III TCNNGA 2 cut(s) 46, 125
HpyCH4III ACNGT 2 cut(s) 22, 203
HpyCH4V TGCA 2 cut(s) 83, 151
HpyF10VI GCNNNNNNNGC 1 cut(s) 163
HpyF3I CTNAG 1 cut(s) 170
Hsp92II CATG 4 cut(s) 49, 151, 155, 161
LpnPI CCDG 1 cut(s) 69
MaeI CTAG 1 cut(s) 213
MaeIII GTNAC 2 cut(s) 9, 207
MboII GAAGA 4 cut(s) 34, 37, 113, 140
MfeI CAATTG 1 cut(s) 247
MluCI AATT 1 cut(s) 247
MnlI CCTC 2 cut(s) 156, 237
Mph1103I ATGCAT 1 cut(s) 153
MseI TTAA 1 cut(s) 17
MslI CAYNNNNRTG 2 cut(s) 44, 156
MunI CAATTG 1 cut(s) 247
MvnI CGCG 1 cut(s) 126
MwoI GCNNNNNNNGC 1 cut(s) 163
NlaIII CATG 4 cut(s) 49, 151, 155, 161
NmuCI GTSAC 2 cut(s) 9, 207
NruI TCGCGA 1 cut(s) 126
NsiI ATGCAT 1 cut(s) 153
NspI RCATGY 1 cut(s) 151
PaeI GCATGC 1 cut(s) 151
PagI TCATGA 1 cut(s) 45
PstNI CAGNNNCTG 1 cut(s) 62
RruI TCGCGA 1 cut(s) 126
RseI CAYNNNNRTG 2 cut(s) 44, 156
SaqAI TTAA 1 cut(s) 17
SetI ASST 4 cut(s) 61, 214, 229, 240
SmiMI CAYNNNNRTG 2 cut(s) 44, 156
SmlI CTYRAG 1 cut(s) 218
SmoI CTYRAG 1 cut(s) 218
SphI GCATGC 1 cut(s) 151
Sse9I AATT 1 cut(s) 247
SspMI CTAG 1 cut(s) 213
TaaI ACNGT 2 cut(s) 22, 203
TaqI TCGA 1 cut(s) 95
TasI AATT 1 cut(s) 247
Tru1I TTAA 1 cut(s) 17
Tru9I TTAA 1 cut(s) 17
TseFI GTSAC 2 cut(s) 9, 207
Tsp45I GTSAC 2 cut(s) 9, 207
TspDTI ATGAA 4 cut(s) 28, 34, 95, 191
TspGWI ACGGA 1 cut(s) 195
XceI RCATGY 1 cut(s) 151
XspI CTAG 1 cut(s) 213
Zsp2I ATGCAT 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.