MD05G1061400.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0013349
Physical Location & Seq
Reverse (-)
10798906 .. 10800029
1124 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1061400.v1.1.491

Sequence Viewer

Length: 279 bp
ATGGCTTTCATGTTCCTCAAGAAGTTCATCATCCTCTTTATTCTGATTTCAGCATCATTTTTATCAACCGCTTTTGCAGCAGGTCGAAAATCGATGTCTGTCAACAAGTTTGCCAAAGAAATGGATGCAACTACAGAGGAAATGTTAGGGAAGCCATTGAACCACAAAGAAGTAGCCAGAATCCATGAAAGGCTGCTTAGAGCTAACACCAAAGACTATGGGCGATATGATCCAGCACCAGCTCTTGTTAAGCCTCCTTTCAAGCTCATTCCGAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.45

Weight (kDa)

9.99

Isoelectric Point (pI)

38.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013349)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G16385 AT4G34600 AT4G34600
fragaria_vesca FvH4_2g09570
malus_domestica MD05G1061400.v1.1 MD10G1069300.v1.1
prunus_persica Prupe.8G091200_v2.0.a1
pyrus_communis pycom05g05270 pycom10g05520
rosa_chinensis RchiOBHm_Chr6g0265861
rosa_multiflora Rmu_sc0000468.1_g000002 Rmu_sc0002730.1_g000001
rosa_rugosa Rorug06G0021100
rosa_samantha Rh6AG142800 Rh6BG142400 Rh6CG139100 Rh6DG126500
rosa_wichuraiana Rw6G012320

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 71
AciI CCGC 1 cut(s) 69
AclWI GGATC 1 cut(s) 224
AgsI TTSAA 2 cut(s) 160, 262
AluBI AGCT 3 cut(s) 203, 242, 265
AluI AGCT 3 cut(s) 203, 242, 265
AlwI GGATC 1 cut(s) 224
ApeKI GCWGC 2 cut(s) 77, 193
BbvI GCAGC 2 cut(s) 89, 180
BfmI CTRYAG 1 cut(s) 132
BfuAI ACCTGC 1 cut(s) 71
BisI GCNGC 2 cut(s) 78, 194
BlsI GCNGC 2 cut(s) 79, 195
BmsI GCATC 2 cut(s) 62, 115
Bsa29I ATCGAT 1 cut(s) 92
BseCI ATCGAT 1 cut(s) 92
BseGI GGATG 2 cut(s) 30, 130
BseXI GCAGC 2 cut(s) 89, 180
BshVI ATCGAT 1 cut(s) 92
Bsp143I GATC 1 cut(s) 229
BspACI CCGC 1 cut(s) 69
BspDI ATCGAT 1 cut(s) 92
BspMI ACCTGC 1 cut(s) 71
BspPI GGATC 1 cut(s) 224
BssMI GATC 1 cut(s) 229
BstDEI CTNAG 1 cut(s) 197
BstF5I GGATG 2 cut(s) 30, 130
BstKTI GATC 1 cut(s) 232
BstMBI GATC 1 cut(s) 229
BstMWI GCNNNNNNNGC 1 cut(s) 77
BstSFI CTRYAG 1 cut(s) 132
BstV1I GCAGC 2 cut(s) 89, 180
BstXI CCANNNNNNTGG 1 cut(s) 121
Bsu15I ATCGAT 1 cut(s) 92
BsuTUI ATCGAT 1 cut(s) 92
BtsCI GGATG 2 cut(s) 30, 130
BveI ACCTGC 1 cut(s) 71
ClaI ATCGAT 1 cut(s) 92
CviAII CATG 2 cut(s) 10, 185
CviJI RGCY 8 cut(s) 5, 154, 176, 193, 203, 242, 253, 265
CviKI_1 RGCY 8 cut(s) 5, 154, 176, 193, 203, 242, 253, 265
DdeI CTNAG 1 cut(s) 197
DpnI GATC 1 cut(s) 231
DpnII GATC 1 cut(s) 229
FaeI CATG 2 cut(s) 13, 188
FaiI YATR 4 cut(s) 11, 186, 219, 228
FatI CATG 2 cut(s) 9, 184
Fnu4HI GCNGC 2 cut(s) 78, 194
FokI GGATG 2 cut(s) 17, 137
Fsp4HI GCNGC 2 cut(s) 78, 194
GluI GCNGC 2 cut(s) 78, 194
Hin1II CATG 2 cut(s) 13, 188
HincII GTYRAC 1 cut(s) 103
HindII GTYRAC 1 cut(s) 103
HinfI GANTC 1 cut(s) 180
Hpy166II GTNNAC 1 cut(s) 103
Hpy188I TCNGA 2 cut(s) 45, 273
Hpy188III TCNNGA 1 cut(s) 19
Hpy8I GTNNAC 1 cut(s) 103
HpyCH4V TGCA 2 cut(s) 77, 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
HpyF3I CTNAG 1 cut(s) 197
Hsp92II CATG 2 cut(s) 13, 188
Kzo9I GATC 1 cut(s) 229
LpnPI CCDG 4 cut(s) 66, 190, 246, 252
Lsp1109I GCAGC 2 cut(s) 89, 180
LweI GCATC 2 cut(s) 62, 115
MalI GATC 1 cut(s) 231
MboI GATC 1 cut(s) 229
MnlI CCTC 4 cut(s) 26, 44, 130, 264
MseI TTAA 1 cut(s) 249
MwoI GCNNNNNNNGC 1 cut(s) 77
NdeII GATC 1 cut(s) 229
NlaIII CATG 2 cut(s) 13, 188
PfeI GAWTC 1 cut(s) 180
PkrI GCNGC 2 cut(s) 79, 195
SaqAI TTAA 1 cut(s) 249
SatI GCNGC 2 cut(s) 78, 194
Sau3AI GATC 1 cut(s) 229
SetI ASST 4 cut(s) 85, 205, 244, 267
SfaNI GCATC 2 cut(s) 62, 115
SfcI CTRYAG 1 cut(s) 132
SmlI CTYRAG 1 cut(s) 17
SmoI CTYRAG 1 cut(s) 17
SsiI CCGC 1 cut(s) 69
TaqI TCGA 2 cut(s) 85, 92
TfiI GAWTC 1 cut(s) 180
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TseI GCWGC 2 cut(s) 77, 193
TspDTI ATGAA 2 cut(s) 16, 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.