Prupe.8G091200_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
12404127 .. 12405358
1232 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G091200.1

Sequence Viewer

Length: 279 bp
ATGGGTTTCATGTTCTTCAACAAGTTCAGCATCCTCTTTCTCCTGATTTCAGCATCATTTTTATCAGCCTCTTTTGCAGCAGGTCGAAGTTCCAAGTTTGTCAATAAGTTGGCCGAAGAAGTGGATGCAATTCCAGAGGAAACGTTAGGGAGGCCATTGAACCACAAGGAAGCTGCCATAATCCATGAAAGGCTGCTGAGAGCTAACACCAGAGACTATGGAAGATATGATCCAGCTCCTGCTCTTGTTAAGCCTCCTTTCAAGCTCATCCCCAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.32

Weight (kDa)

9.52

Isoelectric Point (pI)

44.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013349)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 71
AclI AACGTT 1 cut(s) 143
AclWI GGATC 1 cut(s) 224
AcoI YGGCCR 1 cut(s) 111
AgsI TTSAA 3 cut(s) 19, 160, 262
AluBI AGCT 4 cut(s) 173, 203, 236, 265
AluI AGCT 4 cut(s) 173, 203, 236, 265
Alw26I GTCTC 1 cut(s) 207
AlwI GGATC 1 cut(s) 224
AlwNI CAGNNNCTG 1 cut(s) 239
AoxI GGCC 2 cut(s) 111, 152
ApeKI GCWGC 3 cut(s) 77, 173, 193
BbvI GCAGC 3 cut(s) 89, 160, 180
BcoDI GTCTC 1 cut(s) 207
BfuAI ACCTGC 1 cut(s) 71
BisI GCNGC 3 cut(s) 78, 174, 194
BlsI GCNGC 3 cut(s) 79, 175, 195
BmsI GCATC 3 cut(s) 39, 62, 115
BseGI GGATG 3 cut(s) 30, 130, 267
BseMII CTCAG 1 cut(s) 188
BseXI GCAGC 3 cut(s) 89, 160, 180
BshFI GGCC 2 cut(s) 113, 154
BsmAI GTCTC 1 cut(s) 207
BsnI GGCC 2 cut(s) 113, 154
Bsp143I GATC 1 cut(s) 229
BspANI GGCC 2 cut(s) 113, 154
BspCNI CTCAG 1 cut(s) 189
BspMI ACCTGC 1 cut(s) 71
BspPI GGATC 1 cut(s) 224
BssMI GATC 1 cut(s) 229
BstDEI CTNAG 1 cut(s) 197
BstF5I GGATG 3 cut(s) 30, 130, 267
BstKTI GATC 1 cut(s) 232
BstMAI GTCTC 1 cut(s) 207
BstMBI GATC 1 cut(s) 229
BstMWI GCNNNNNNNGC 1 cut(s) 74
BstV1I GCAGC 3 cut(s) 89, 160, 180
BsuRI GGCC 2 cut(s) 113, 154
BtsCI GGATG 3 cut(s) 30, 130, 267
BveI ACCTGC 1 cut(s) 71
CaiI CAGNNNCTG 1 cut(s) 239
CviAII CATG 2 cut(s) 10, 185
CviJI RGCY 9 cut(s) 68, 113, 154, 173, 193, 203, 236, 253, 265
CviKI_1 RGCY 9 cut(s) 68, 113, 154, 173, 193, 203, 236, 253, 265
DdeI CTNAG 1 cut(s) 197
DpnI GATC 1 cut(s) 231
DpnII GATC 1 cut(s) 229
EaeI YGGCCR 1 cut(s) 111
FaeI CATG 2 cut(s) 13, 188
FaiI YATR 5 cut(s) 11, 179, 186, 219, 228
FatI CATG 2 cut(s) 9, 184
Fnu4HI GCNGC 3 cut(s) 78, 174, 194
FokI GGATG 3 cut(s) 17, 137, 254
Fsp4HI GCNGC 3 cut(s) 78, 174, 194
GluI GCNGC 3 cut(s) 78, 174, 194
HaeIII GGCC 2 cut(s) 113, 154
Hin1II CATG 2 cut(s) 13, 188
Hpy188III TCNNGA 2 cut(s) 43, 134
HpyCH4IV ACGT 1 cut(s) 143
HpyCH4V TGCA 2 cut(s) 77, 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 74
HpyF3I CTNAG 1 cut(s) 197
HpySE526I ACGT 1 cut(s) 143
Hsp92II CATG 2 cut(s) 13, 188
Kzo9I GATC 1 cut(s) 229
LmnI GCTCC 1 cut(s) 241
LpnPI CCDG 6 cut(s) 56, 66, 147, 223, 246, 252
Lsp1109I GCAGC 3 cut(s) 89, 160, 180
LweI GCATC 3 cut(s) 39, 62, 115
MaeII ACGT 1 cut(s) 143
MalI GATC 1 cut(s) 231
MboI GATC 1 cut(s) 229
MboII GAAGA 3 cut(s) 7, 128, 234
MluCI AATT 1 cut(s) 129
MnlI CCTC 5 cut(s) 44, 79, 130, 144, 264
MseI TTAA 1 cut(s) 249
MwoI GCNNNNNNNGC 1 cut(s) 74
NdeII GATC 1 cut(s) 229
NlaIII CATG 2 cut(s) 13, 188
PkrI GCNGC 3 cut(s) 79, 175, 195
Psp1406I AACGTT 1 cut(s) 143
PstNI CAGNNNCTG 1 cut(s) 239
SaqAI TTAA 1 cut(s) 249
SatI GCNGC 3 cut(s) 78, 174, 194
Sau3AI GATC 1 cut(s) 229
SetI ASST 6 cut(s) 85, 146, 175, 205, 238, 267
SfaNI GCATC 3 cut(s) 39, 62, 115
Sse9I AATT 1 cut(s) 129
TaiI ACGT 1 cut(s) 146
TaqI TCGA 1 cut(s) 85
TasI AATT 1 cut(s) 129
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TseI GCWGC 3 cut(s) 77, 173, 193
TspDTI ATGAA 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.