AT4G34600

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
Physical Location & Seq
Forward (+)
16529058 .. 16530228
1171 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G34600.2

Sequence Viewer

Length: 252 bp
ATGGGTTTGTTGCCATTGGTGAAGAAACTAGGTTTCATCATCTTTCTTCTAGTTTCAGCTTCAGCGTTTGCTCTCTGTTCTGCAGGCCGATCATCCATTTTAATCTATAGCCAAGAAGATGATCATCCCGAGGTAGTAGAAAGAAGAATACATGAGCATGAGAGAATTCTGAGAATGAATTCAAGAGACTATGGCCACTCCAGTCCTAAACCAAAGCTCGTGAGACCTCCTTTCAAGCTTATTCCCAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

9.44

Weight (kDa)

9.65

Isoelectric Point (pI)

52.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013349)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 193
AcsI RAATTY 2 cut(s) 165, 178
AcuI CTGAAG 1 cut(s) 45
AgsI TTSAA 2 cut(s) 183, 235
AluBI AGCT 3 cut(s) 59, 217, 238
AluI AGCT 3 cut(s) 59, 217, 238
Alw26I GTCTC 2 cut(s) 180, 217
Ama87I CYCGRG 1 cut(s) 128
AoxI GGCC 2 cut(s) 85, 193
ApoI RAATTY 2 cut(s) 165, 178
Asp700I GAANNNNTTC 1 cut(s) 178
AsuHPI GGTGA 1 cut(s) 31
AvaI CYCGRG 1 cut(s) 128
BalI TGGCCA 1 cut(s) 195
BauI CACGAG 1 cut(s) 218
BclI TGATCA 1 cut(s) 121
BcoDI GTCTC 2 cut(s) 180, 217
BfaI CTAG 2 cut(s) 29, 50
BfmI CTRYAG 2 cut(s) 81, 106
BmeT110I CYCGRG 1 cut(s) 128
BpmI CTGGAG 1 cut(s) 184
BsaBI GATNNNNATC 1 cut(s) 123
BsaI GGTCTC 1 cut(s) 217
BsaJI CCNNGG 1 cut(s) 129
Bse1I ACTGG 1 cut(s) 201
Bse8I GATNNNNATC 1 cut(s) 123
BseDI CCNNGG 1 cut(s) 129
BseGI GGATG 2 cut(s) 92, 124
BseJI GATNNNNATC 1 cut(s) 123
BseMII CTCAG 1 cut(s) 161
BseNI ACTGG 1 cut(s) 201
BshFI GGCC 2 cut(s) 87, 195
BsiHKCI CYCGRG 1 cut(s) 128
BsmAI GTCTC 2 cut(s) 180, 217
BsnI GGCC 2 cut(s) 87, 195
Bso31I GGTCTC 1 cut(s) 217
BsoBI CYCGRG 1 cut(s) 128
Bsp143I GATC 2 cut(s) 89, 121
BspANI GGCC 2 cut(s) 87, 195
BspCNI CTCAG 1 cut(s) 162
BspMAI CTGCAG 1 cut(s) 85
BspTNI GGTCTC 1 cut(s) 217
BsrI ACTGG 1 cut(s) 201
BssECI CCNNGG 1 cut(s) 129
BssMI GATC 2 cut(s) 89, 121
BssSI CACGAG 1 cut(s) 218
Bst2BI CACGAG 1 cut(s) 218
BstC8I GCNNGC 1 cut(s) 85
BstDEI CTNAG 1 cut(s) 170
BstF5I GGATG 2 cut(s) 92, 124
BstKTI GATC 2 cut(s) 92, 124
BstMAI GTCTC 2 cut(s) 180, 217
BstMBI GATC 2 cut(s) 89, 121
BstSFI CTRYAG 2 cut(s) 81, 106
BsuRI GGCC 2 cut(s) 87, 195
BtsCI GGATG 2 cut(s) 92, 124
Cac8I GCNNGC 1 cut(s) 85
CviAII CATG 2 cut(s) 152, 158
CviJI RGCY 6 cut(s) 59, 87, 111, 195, 217, 238
CviKI_1 RGCY 6 cut(s) 59, 87, 111, 195, 217, 238
DdeI CTNAG 1 cut(s) 170
DpnI GATC 2 cut(s) 91, 123
DpnII GATC 2 cut(s) 89, 121
EaeI YGGCCR 1 cut(s) 193
Eco31I GGTCTC 1 cut(s) 217
Eco57I CTGAAG 1 cut(s) 45
Eco88I CYCGRG 1 cut(s) 128
EcoRI GAATTC 2 cut(s) 165, 178
FaeI CATG 2 cut(s) 155, 161
FaiI YATR 4 cut(s) 108, 153, 159, 192
FatI CATG 2 cut(s) 151, 157
FbaI TGATCA 1 cut(s) 121
FokI GGATG 2 cut(s) 79, 111
FspBI CTAG 2 cut(s) 29, 50
GsuI CTGGAG 1 cut(s) 184
HaeIII GGCC 2 cut(s) 87, 195
Hin1II CATG 2 cut(s) 155, 161
HindIII AAGCTT 1 cut(s) 236
HphI GGTGA 1 cut(s) 31
Hpy188I TCNGA 1 cut(s) 171
Hpy188III TCNNGA 3 cut(s) 128, 183, 220
HpyCH4V TGCA 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 170
Hsp92II CATG 2 cut(s) 155, 161
Ksp22I TGATCA 1 cut(s) 121
Kzo9I GATC 2 cut(s) 89, 121
LpnPI CCDG 2 cut(s) 69, 214
MaeI CTAG 2 cut(s) 29, 50
MalI GATC 2 cut(s) 91, 123
MboI GATC 2 cut(s) 89, 121
MboII GAAGA 4 cut(s) 34, 38, 128, 156
MlsI TGGCCA 1 cut(s) 195
MluCI AATT 2 cut(s) 165, 178
MluNI TGGCCA 1 cut(s) 195
MnlI CCTC 2 cut(s) 124, 237
Mox20I TGGCCA 1 cut(s) 195
MroXI GAANNNNTTC 1 cut(s) 178
MscI TGGCCA 1 cut(s) 195
MseI TTAA 1 cut(s) 101
MslI CAYNNNNRTG 1 cut(s) 156
Msp20I TGGCCA 1 cut(s) 195
NdeII GATC 2 cut(s) 89, 121
NlaIII CATG 2 cut(s) 155, 161
PdmI GAANNNNTTC 1 cut(s) 178
PstI CTGCAG 1 cut(s) 85
RseI CAYNNNNRTG 1 cut(s) 156
SaqAI TTAA 1 cut(s) 101
Sau3AI GATC 2 cut(s) 89, 121
SetI ASST 6 cut(s) 34, 61, 135, 219, 229, 240
SfcI CTRYAG 2 cut(s) 81, 106
SmiMI CAYNNNNRTG 1 cut(s) 156
Sse9I AATT 2 cut(s) 165, 178
SspMI CTAG 2 cut(s) 29, 50
TasI AATT 2 cut(s) 165, 178
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TspDTI ATGAA 2 cut(s) 25, 191
XapI RAATTY 2 cut(s) 165, 178
XmnI GAANNNNTTC 1 cut(s) 178
XspI CTAG 2 cut(s) 29, 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.