AT3G01050

May serve as docking site to facilitate the association of other proteins to the plasma membrane

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0005273
Physical Location & Seq
Forward (+)
13046 .. 15906
2861 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G01050.5

Sequence Viewer

Length: 354 bp
ATGGCAGAAGTCCATAATCAACTAGAGATCAAGTTTCGGTTAACCGATGGTTCGGATATCGGTCCTAAAGCATTCCCTGATGCTACAACTGTTTCGGCTTTGAAGGAAACTGTTATTTCTGAATGGCCAAGAGAGAAGGAGAATGGGCCGAAAACAGTGAAAGAGGTGAAGTTGATAAGCGCAGGGAAGGTATTGGAGAACAGCAAGACGGTTAAAGACTACCGAAGTCCTGTCTCTAATCTCGCAGGCGCTGTCACCACAATGCACGTTATCATCCAAGCTCCGGTTACGGAAAAAGAAAAGAAGCCTAAAGGTGACCCGAAGATGAACAAATGCGTCTGTTCAGTCATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rad60-SLD_2

Protein Analysis

117

Amino Acids

12.82

Weight (kDa)

9.1

Isoelectric Point (pI)

27.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD_2 PF13881 7 - 115 1.1e-42 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 125
AfiI CCNNNNNNNGG 1 cut(s) 283
AgsI TTSAA 1 cut(s) 103
AluBI AGCT 1 cut(s) 281
AluI AGCT 1 cut(s) 281
Alw26I GTCTC 1 cut(s) 238
AlwNI CAGNNNCTG 1 cut(s) 251
AoxI GGCC 2 cut(s) 125, 146
AspLEI GCGC 2 cut(s) 182, 251
AspS9I GGNCC 2 cut(s) 62, 146
AsuHPI GGTGA 3 cut(s) 178, 247, 326
AvaII GGWCC 1 cut(s) 62
BalI TGGCCA 1 cut(s) 127
BccI CCATC 1 cut(s) 41
BcoDI GTCTC 1 cut(s) 238
BfaI CTAG 1 cut(s) 23
BfoI RGCGCY 1 cut(s) 252
Bme18I GGWCC 1 cut(s) 62
BmgT120I GGNCC 2 cut(s) 62, 146
BmsI GCATC 1 cut(s) 70
BsaWI WCCGGW 1 cut(s) 283
Bsc4I CCNNNNNNNGG 1 cut(s) 283
BseGI GGATG 1 cut(s) 273
BseLI CCNNNNNNNGG 1 cut(s) 283
BshFI GGCC 2 cut(s) 127, 148
BsiSI CCGG 1 cut(s) 284
BslI CCNNNNNNNGG 1 cut(s) 283
BsmAI GTCTC 1 cut(s) 238
BsmI GAATGC 1 cut(s) 71
BsnI GGCC 2 cut(s) 127, 148
Bsp143I GATC 1 cut(s) 27
BspANI GGCC 2 cut(s) 127, 148
BssMI GATC 1 cut(s) 27
Bst4CI ACNGT 4 cut(s) 91, 112, 157, 211
BstC8I GCNNGC 1 cut(s) 247
BstEII GGTNACC 1 cut(s) 314
BstF5I GGATG 1 cut(s) 273
BstH2I RGCGCY 1 cut(s) 252
BstHHI GCGC 2 cut(s) 182, 251
BstKTI GATC 1 cut(s) 30
BstMAI GTCTC 1 cut(s) 238
BstMBI GATC 1 cut(s) 27
BstPI GGTNACC 1 cut(s) 314
BsuRI GGCC 2 cut(s) 127, 148
BtsCI GGATG 1 cut(s) 273
BtsIMutI CAGTG 1 cut(s) 162
Cac8I GCNNGC 1 cut(s) 247
CaiI CAGNNNCTG 1 cut(s) 251
CfoI GCGC 2 cut(s) 182, 251
Cfr13I GGNCC 2 cut(s) 62, 146
CseI GACGC 1 cut(s) 325
CviAII CATG 1 cut(s) 349
CviJI RGCY 5 cut(s) 98, 127, 148, 281, 307
CviKI_1 RGCY 5 cut(s) 98, 127, 148, 281, 307
DpnI GATC 1 cut(s) 29
DpnII GATC 1 cut(s) 27
EaeI YGGCCR 1 cut(s) 125
Eco32I GATATC 1 cut(s) 58
Eco47I GGWCC 1 cut(s) 62
Eco91I GGTNACC 1 cut(s) 314
EcoO65I GGTNACC 1 cut(s) 314
EcoRV GATATC 1 cut(s) 58
FaeI CATG 1 cut(s) 352
FaiI YATR 2 cut(s) 15, 350
FatI CATG 1 cut(s) 348
FokI GGATG 1 cut(s) 260
FspBI CTAG 1 cut(s) 23
GlaI GCGC 2 cut(s) 181, 250
HaeII RGCGCY 1 cut(s) 252
HaeIII GGCC 2 cut(s) 127, 148
HapII CCGG 1 cut(s) 284
HgaI GACGC 1 cut(s) 325
HhaI GCGC 2 cut(s) 182, 251
Hin1II CATG 1 cut(s) 352
Hin6I GCGC 2 cut(s) 180, 249
HinP1I GCGC 2 cut(s) 180, 249
HincII GTYRAC 1 cut(s) 42
HindII GTYRAC 1 cut(s) 42
HpaI GTTAAC 1 cut(s) 42
HpaII CCGG 1 cut(s) 284
HphI GGTGA 3 cut(s) 178, 247, 326
Hpy166II GTNNAC 1 cut(s) 42
Hpy188I TCNGA 2 cut(s) 55, 121
Hpy8I GTNNAC 1 cut(s) 42
HpyAV CCTTC 3 cut(s) 97, 130, 181
HpyCH4III ACNGT 4 cut(s) 91, 112, 157, 211
HpyCH4IV ACGT 1 cut(s) 267
HpyCH4V TGCA 1 cut(s) 265
HpySE526I ACGT 1 cut(s) 267
Hsp92II CATG 1 cut(s) 352
HspAI GCGC 2 cut(s) 180, 249
KspAI GTTAAC 1 cut(s) 42
Kzo9I GATC 1 cut(s) 27
LmnI GCTCC 1 cut(s) 286
LpnPI CCDG 5 cut(s) 90, 168, 231, 243, 297
LweI GCATC 1 cut(s) 70
MaeI CTAG 1 cut(s) 23
MaeII ACGT 1 cut(s) 267
MaeIII GTNAC 3 cut(s) 253, 286, 314
MalI GATC 1 cut(s) 29
MboI GATC 1 cut(s) 27
MboII GAAGA 1 cut(s) 334
MlsI TGGCCA 1 cut(s) 127
MluNI TGGCCA 1 cut(s) 127
MnlI CCTC 1 cut(s) 157
Mox20I TGGCCA 1 cut(s) 127
MscI TGGCCA 1 cut(s) 127
MseI TTAA 2 cut(s) 41, 213
MslI CAYNNNNRTG 1 cut(s) 260
Msp20I TGGCCA 1 cut(s) 127
MspI CCGG 1 cut(s) 284
Mva1269I GAATGC 1 cut(s) 71
NdeII GATC 1 cut(s) 27
NlaIII CATG 1 cut(s) 352
NmuCI GTSAC 2 cut(s) 253, 314
PctI GAATGC 1 cut(s) 71
PspEI GGTNACC 1 cut(s) 314
PspPI GGNCC 2 cut(s) 62, 146
PstNI CAGNNNCTG 1 cut(s) 251
RseI CAYNNNNRTG 1 cut(s) 260
SaqAI TTAA 2 cut(s) 41, 213
Sau3AI GATC 1 cut(s) 27
Sau96I GGNCC 2 cut(s) 62, 146
SetI ASST 5 cut(s) 168, 192, 270, 283, 316
SfaNI GCATC 1 cut(s) 70
SinI GGWCC 1 cut(s) 62
SmiMI CAYNNNNRTG 1 cut(s) 260
SspMI CTAG 1 cut(s) 23
TaaI ACNGT 4 cut(s) 91, 112, 157, 211
TaiI ACGT 1 cut(s) 270
TaqII GACCGA 1 cut(s) 50
Tru1I TTAA 2 cut(s) 41, 213
Tru9I TTAA 2 cut(s) 41, 213
TscAI CASTG 1 cut(s) 162
TseFI GTSAC 2 cut(s) 253, 314
Tsp45I GTSAC 2 cut(s) 253, 314
TspDTI ATGAA 1 cut(s) 341
TspGWI ACGGA 1 cut(s) 305
TspRI CASTG 1 cut(s) 162
VpaK11BI GGWCC 1 cut(s) 62
XspI CTAG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.