Rmu_sc0003016.1_g000005

May serve as docking site to facilitate the association of other proteins to the plasma membrane

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003016.1
OG0005273
Physical Location & Seq
Reverse (-)
8381 .. 10382
2002 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003016.1_g000005.1.cds

Sequence Viewer

Length: 471 bp
atggctggagtgcaagaccaattggaaatcaagtttcggttgagtgatggatcagatattggtcccaaaagctttcctgctgctacaagtgtttcgaccttgaaagaaagtattcttgcgcaatggcctaaagacaaggagaatggtccaaggactgttaaagatgtcaagctgataagtgcaggaaagatattggagaacaacagaacagttggggagtgccgaagcccaatatgcgatgttcctacaactatgcatgtcgttgttcaaccaccttcttcggagaaagttcaaatagtggggataacatcatttttaggtagagagagagttggagctagtgaagaaaatggatttggtgaaactgattcatctatattggaaatatgcaggcttcatagaatcatatgtcattgttttgttcaggtccatcatactttgtttgttttcaactctattagactatgctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rad60-SLD_2

Protein Analysis

156

Amino Acids

17.18

Weight (kDa)

6.95

Isoelectric Point (pI)

38.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 120
AclWI GGATC 1 cut(s) 58
AgsI TTSAA 4 cut(s) 103, 269, 293, 451
AjuI GAANNNNNNNTTGG 2 cut(s) 339, 371
AluBI AGCT 3 cut(s) 72, 172, 338
AluI AGCT 3 cut(s) 72, 172, 338
AlwI GGATC 1 cut(s) 58
AoxI GGCC 1 cut(s) 125
ApeKI GCWGC 1 cut(s) 80
Asp700I GAANNNNTTC 1 cut(s) 111
AspLEI GCGC 1 cut(s) 121
AspS9I GGNCC 3 cut(s) 62, 146, 427
AsuHPI GGTGA 1 cut(s) 371
AvaII GGWCC 3 cut(s) 62, 146, 427
BbvI GCAGC 1 cut(s) 67
BccI CCATC 2 cut(s) 41, 438
BfaI CTAG 1 cut(s) 339
BisI GCNGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 82
Bme18I GGWCC 3 cut(s) 62, 146, 427
BmgT120I GGNCC 3 cut(s) 62, 146, 427
BmiI GGNNCC 1 cut(s) 64
BpmI CTGGAG 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 149
Bse3DI GCAATG 1 cut(s) 128
BseDI CCNNGG 1 cut(s) 149
BseMI GCAATG 1 cut(s) 128
BseXI GCAGC 1 cut(s) 67
BsgI GTGCAG 1 cut(s) 201
BshFI GGCC 1 cut(s) 127
BslFI GGGAC 1 cut(s) 48
BsmFI GGGAC 1 cut(s) 48
BsnI GGCC 1 cut(s) 127
Bsp143I GATC 1 cut(s) 50
BspANI GGCC 1 cut(s) 127
BspLI GGNNCC 1 cut(s) 64
BspPI GGATC 1 cut(s) 58
BsrDI GCAATG 1 cut(s) 128
BssECI CCNNGG 1 cut(s) 149
BssMI GATC 1 cut(s) 50
BssT1I CCWWGG 1 cut(s) 149
Bst4CI ACNGT 2 cut(s) 157, 211
BstC8I GCNNGC 1 cut(s) 392
BstHHI GCGC 1 cut(s) 121
BstKTI GATC 1 cut(s) 53
BstMBI GATC 1 cut(s) 50
BstMWI GCNNNNNNNGC 1 cut(s) 234
BstNSI RCATGY 1 cut(s) 260
BstV1I GCAGC 1 cut(s) 67
BsuRI GGCC 1 cut(s) 127
BtgZI GCGATG 1 cut(s) 252
Cac8I GCNNGC 1 cut(s) 392
CfoI GCGC 1 cut(s) 121
Cfr13I GGNCC 3 cut(s) 62, 146, 427
CviAII CATG 1 cut(s) 257
CviJI RGCY 7 cut(s) 5, 72, 127, 172, 228, 338, 394
CviKI_1 RGCY 7 cut(s) 5, 72, 127, 172, 228, 338, 394
DpnI GATC 1 cut(s) 52
DpnII GATC 1 cut(s) 50
Eco130I CCWWGG 1 cut(s) 149
Eco47I GGWCC 3 cut(s) 62, 146, 427
EcoT14I CCWWGG 1 cut(s) 149
EcoT22I ATGCAT 1 cut(s) 258
ErhI CCWWGG 1 cut(s) 149
FaeI CATG 1 cut(s) 260
FaqI GGGAC 1 cut(s) 48
FatI CATG 1 cut(s) 256
FauNDI CATATG 1 cut(s) 407
Fnu4HI GCNGC 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 81
FspBI CTAG 1 cut(s) 339
FspI TGCGCA 1 cut(s) 120
GlaI GCGC 1 cut(s) 120
GluI GCNGC 1 cut(s) 81
GsuI CTGGAG 1 cut(s) 27
HaeIII GGCC 1 cut(s) 127
HhaI GCGC 1 cut(s) 121
Hin1II CATG 1 cut(s) 260
Hin6I GCGC 1 cut(s) 119
HinP1I GCGC 1 cut(s) 119
HindIII AAGCTT 1 cut(s) 70
HinfI GANTC 2 cut(s) 368, 402
HphI GGTGA 1 cut(s) 371
Hpy188I TCNGA 2 cut(s) 55, 283
HpyAV CCTTC 1 cut(s) 285
HpyCH4III ACNGT 2 cut(s) 157, 211
HpyCH4V TGCA 4 cut(s) 13, 182, 256, 390
HpyF10VI GCNNNNNNNGC 1 cut(s) 234
Hsp92II CATG 1 cut(s) 260
HspAI GCGC 1 cut(s) 119
Kzo9I GATC 1 cut(s) 50
LmnI GCTCC 1 cut(s) 335
LpnPI CCDG 4 cut(s) 90, 168, 376, 410
Lsp1109I GCAGC 1 cut(s) 67
MaeI CTAG 1 cut(s) 339
MalI GATC 1 cut(s) 52
MboI GATC 1 cut(s) 50
MboII GAAGA 2 cut(s) 270, 356
MfeI CAATTG 1 cut(s) 20
MluCI AATT 1 cut(s) 20
MmeI TCCRAC 1 cut(s) 313
Mph1103I ATGCAT 1 cut(s) 258
MroXI GAANNNNTTC 1 cut(s) 111
MseI TTAA 1 cut(s) 159
MunI CAATTG 1 cut(s) 20
MwoI GCNNNNNNNGC 1 cut(s) 234
NdeI CATATG 1 cut(s) 407
NdeII GATC 1 cut(s) 50
NlaIII CATG 1 cut(s) 260
NlaIV GGNNCC 1 cut(s) 64
NsbI TGCGCA 1 cut(s) 120
NsiI ATGCAT 1 cut(s) 258
NspI RCATGY 1 cut(s) 260
PdmI GAANNNNTTC 1 cut(s) 111
PfeI GAWTC 2 cut(s) 368, 402
PkrI GCNGC 1 cut(s) 82
PspN4I GGNNCC 1 cut(s) 64
PspPI GGNCC 3 cut(s) 62, 146, 427
SaqAI TTAA 1 cut(s) 159
SatI GCNGC 1 cut(s) 81
Sau3AI GATC 1 cut(s) 50
Sau96I GGNCC 3 cut(s) 62, 146, 427
SetI ASST 7 cut(s) 74, 101, 174, 277, 322, 340, 429
SinI GGWCC 3 cut(s) 62, 146, 427
Sse9I AATT 1 cut(s) 20
SspMI CTAG 1 cut(s) 339
StyI CCWWGG 1 cut(s) 149
TaaI ACNGT 2 cut(s) 157, 211
TaqI TCGA 1 cut(s) 95
TasI AATT 1 cut(s) 20
TfiI GAWTC 2 cut(s) 368, 402
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TseI GCWGC 1 cut(s) 80
TspDTI ATGAA 2 cut(s) 360, 386
VpaK11BI GGWCC 3 cut(s) 62, 146, 427
XceI RCATGY 1 cut(s) 260
XmnI GAANNNNTTC 1 cut(s) 111
XspI CTAG 1 cut(s) 339
Zsp2I ATGCAT 1 cut(s) 258
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.