Basic Information

Type: gene

Biological Identity

Species

arabidopsis_thaliana

Chromosome

Orthogroup ID

OG0019126

Physical Location & Seq

Genomic Coordinates Forward (+)

6360135 .. 6360532

Gene Structure 398 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

AT3G18518.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 162 bp

ATGAGGGAGAAGTACACAAAGGAGGAAGCAGTGAAGAATTGGGAGAAGAAGAAGAACAAGCCTTCTTCACCAAAAGGAGTTGGAGAGTTTCTGAAAAAGAAGAAAGGAAGGTTCTACATTATTGGAAAATGTATTACTATGCTTCTTTGTTCACACAAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_3 zf-RVT

Protein Analysis

53

Amino Acids

6.25

Weight (kDa)

10.02

Isoelectric Point (pI)

30.23

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DVL	PF08137	32 - 50	1.6e-10	DVL family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019126)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G18518 AT4G35783
malus_domestica	MD02G1122600.v1.1
prunus_persica	Prupe.7G175900_v2.0.a1
pyrus_communis	pycom02g09560
rosa_chinensis	RchiOBHm_Chr2g0098221
rosa_roxburghii	Rroxscaffold_2G00144150
rosa_wichuraiana	Rw2G009280

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	14
AleI	CACNNNNGTG	1 cut(s)	157
AsuHPI	GGTGA	1 cut(s)	60
BtsI	GCAGTG	1 cut(s)	36
BtsIMutI	CAGTG	1 cut(s)	36
Csp6I	GTAC	1 cut(s)	13
CviJI	RGCY	1 cut(s)	61
CviKI_1	RGCY	1 cut(s)	61
CviQI	GTAC	1 cut(s)	13
FaiI	YATR	1 cut(s)	140
HphI	GGTGA	1 cut(s)	60
Hpy166II	GTNNAC	2 cut(s)	15, 152
Hpy188I	TCNGA	1 cut(s)	93
Hpy8I	GTNNAC	2 cut(s)	15, 152
HpyAV	CCTTC	2 cut(s)	72, 102
MboII	GAAGA	6 cut(s)	46, 57, 58, 61, 64, 112
MluCI	AATT	1 cut(s)	37
MmeI	TCCRAC	1 cut(s)	61
MnlI	CCTC	1 cut(s)	16
MslI	CAYNNNNRTG	1 cut(s)	157
OliI	CACNNNNGTG	1 cut(s)	157
RsaI	GTAC	1 cut(s)	14
RsaNI	GTAC	1 cut(s)	13
RseI	CAYNNNNRTG	1 cut(s)	157
SetI	ASST	1 cut(s)	113
SgeI	CNNG	1 cut(s)	70
SmiMI	CAYNNNNRTG	1 cut(s)	157
Sse9I	AATT	1 cut(s)	37
TasI	AATT	1 cut(s)	37
TatI	WGTACW	1 cut(s)	12
TscAI	CASTG	1 cut(s)	36
TspRI	CASTG	1 cut(s)	36

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.