AT4G35783

DVL family

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
Physical Location & Seq
Forward (+)
16952406 .. 16952947
542 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G35783.1

Sequence Viewer

Length: 189 bp
ATGGGGCAATGCTCATCGGCGACAAAGATGAGGAGAAAGAGGAAAAGGGAAGAAGAATGTTGCAGAGAATCAATGGAGAGGAGGAATAAAGGATGTTTAGCCATGGTGAAGGAGAGACGTTCTAGGTTTTATATAGCTAGAAGATGTATTCTTATGTTGCTTTGTTGGCACAAATACGCCAATTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.58

Weight (kDa)

10.25

Isoelectric Point (pI)

124.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DVL PF08137 37 - 55 6.5e-10 DVL family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019126)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G18518 AT4G35783
malus_domestica MD02G1122600.v1.1
prunus_persica Prupe.7G175900_v2.0.a1
pyrus_communis pycom02g09560
rosa_chinensis RchiOBHm_Chr2g0098221
rosa_roxburghii Rroxscaffold_2G00144150
rosa_wichuraiana Rw2G009280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
Alw26I GTCTC 1 cut(s) 109
AsuHPI GGTGA 1 cut(s) 118
BcoDI GTCTC 1 cut(s) 109
BfaI CTAG 2 cut(s) 123, 138
BsaJI CCNNGG 1 cut(s) 102
Bse3DI GCAATG 1 cut(s) 14
BseDI CCNNGG 1 cut(s) 102
BseGI GGATG 1 cut(s) 98
BseMI GCAATG 1 cut(s) 14
BseRI GAGGAG 2 cut(s) 46, 94
BsmAI GTCTC 1 cut(s) 109
BsmBI CGTCTC 1 cut(s) 109
Bsp19I CCATGG 1 cut(s) 102
BsrDI GCAATG 1 cut(s) 14
BssECI CCNNGG 1 cut(s) 102
BssT1I CCWWGG 1 cut(s) 102
BstDSI CCRYGG 1 cut(s) 102
BstF5I GGATG 1 cut(s) 98
BstMAI GTCTC 1 cut(s) 109
BstMWI GCNNNNNNNGC 1 cut(s) 166
BtgI CCRYGG 1 cut(s) 102
BtsCI GGATG 1 cut(s) 98
CviAII CATG 1 cut(s) 103
CviJI RGCY 2 cut(s) 101, 137
CviKI_1 RGCY 2 cut(s) 101, 137
Eco130I CCWWGG 1 cut(s) 102
EcoT14I CCWWGG 1 cut(s) 102
ErhI CCWWGG 1 cut(s) 102
Esp3I CGTCTC 1 cut(s) 109
FaeI CATG 1 cut(s) 106
FaiI YATR 4 cut(s) 104, 132, 134, 155
FatI CATG 1 cut(s) 102
FokI GGATG 1 cut(s) 105
FspBI CTAG 2 cut(s) 123, 138
Hin1II CATG 1 cut(s) 106
HinfI GANTC 1 cut(s) 68
HphI GGTGA 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 186
HpyAV CCTTC 1 cut(s) 103
HpyCH4IV ACGT 1 cut(s) 118
HpyCH4V TGCA 1 cut(s) 63
HpyF10VI GCNNNNNNNGC 1 cut(s) 166
HpySE526I ACGT 1 cut(s) 118
Hsp92II CATG 1 cut(s) 106
MaeI CTAG 2 cut(s) 123, 138
MaeII ACGT 1 cut(s) 118
MboII GAAGA 3 cut(s) 62, 65, 153
MluCI AATT 1 cut(s) 181
MnlI CCTC 4 cut(s) 24, 33, 72, 75
MwoI GCNNNNNNNGC 1 cut(s) 166
NcoI CCATGG 1 cut(s) 102
NlaIII CATG 1 cut(s) 106
PfeI GAWTC 1 cut(s) 68
SetI ASST 3 cut(s) 121, 128, 139
SgeI CNNG 3 cut(s) 115, 135, 150
Sse9I AATT 1 cut(s) 181
SspMI CTAG 2 cut(s) 123, 138
StyI CCWWGG 1 cut(s) 102
TaiI ACGT 1 cut(s) 121
TasI AATT 1 cut(s) 181
TfiI GAWTC 1 cut(s) 68
XspI CTAG 2 cut(s) 123, 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.