Prupe.7G175900_v2.0.a1

DVL family

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Reverse (-)
17491082 .. 17491288
207 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G175900.1

Sequence Viewer

Length: 207 bp
ATGGGTCAATGCACATCAAAGCAAGTGAGGCGTAAAGGGTTGGGTGGGTCTTCTTCTTCAAGTTCATCTGGAGGTGGAGGTGGAGGTGGTGGGTGTGCAGTGAGGCAAGGATGTTGGAGCATGATCAGAGAGAAAAGGTCCAGGTTCTATATTGCTAGGAGGTGTGTGGTGATGCTTCTTTGTTGGCACAAATATGGCAAGTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.35

Weight (kDa)

10.46

Isoelectric Point (pI)

95.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019126)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G18518 AT4G35783
malus_domestica MD02G1122600.v1.1
prunus_persica Prupe.7G175900_v2.0.a1
pyrus_communis pycom02g09560
rosa_chinensis RchiOBHm_Chr2g0098221
rosa_roxburghii Rroxscaffold_2G00144150
rosa_wichuraiana Rw2G009280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 60
AjnI CCWGG 1 cut(s) 140
AspS9I GGNCC 1 cut(s) 138
AsuHPI GGTGA 1 cut(s) 181
AvaII GGWCC 1 cut(s) 138
BbsI GAAGAC 1 cut(s) 42
BciT130I CCWGG 1 cut(s) 142
BclI TGATCA 1 cut(s) 123
BfaI CTAG 1 cut(s) 156
Bme1390I CCNGG 1 cut(s) 142
Bme18I GGWCC 1 cut(s) 138
BmgT120I GGNCC 1 cut(s) 138
BmrFI CCNGG 1 cut(s) 142
BmsI GCATC 1 cut(s) 162
BpiI GAAGAC 1 cut(s) 42
BpmI CTGGAG 1 cut(s) 90
BseBI CCWGG 1 cut(s) 142
BseGI GGATG 1 cut(s) 116
BsgI GTGCAG 1 cut(s) 117
Bsp143I GATC 1 cut(s) 123
BssMI GATC 1 cut(s) 123
Bst2UI CCWGG 1 cut(s) 142
BstF5I GGATG 1 cut(s) 116
BstKTI GATC 1 cut(s) 126
BstMBI GATC 1 cut(s) 123
BstMWI GCNNNNNNNGC 1 cut(s) 28
BstNI CCWGG 1 cut(s) 142
BstSCI CCNGG 1 cut(s) 140
BstV2I GAAGAC 1 cut(s) 42
BtsCI GGATG 1 cut(s) 116
BtsI GCAGTG 1 cut(s) 105
BtsIMutI CAGTG 1 cut(s) 105
Cfr13I GGNCC 1 cut(s) 138
CviAII CATG 1 cut(s) 121
DpnI GATC 1 cut(s) 125
DpnII GATC 1 cut(s) 123
Eco47I GGWCC 1 cut(s) 138
EcoRII CCWGG 1 cut(s) 140
FaeI CATG 1 cut(s) 124
FaiI YATR 3 cut(s) 122, 150, 195
FatI CATG 1 cut(s) 120
FbaI TGATCA 1 cut(s) 123
FokI GGATG 1 cut(s) 123
FspBI CTAG 1 cut(s) 156
GsuI CTGGAG 1 cut(s) 90
Hin1II CATG 1 cut(s) 124
HphI GGTGA 1 cut(s) 181
Hpy188I TCNGA 1 cut(s) 128
Hpy188III TCNNGA 1 cut(s) 69
HpyCH4V TGCA 2 cut(s) 12, 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 28
Hsp92II CATG 1 cut(s) 124
Ksp22I TGATCA 1 cut(s) 123
Kzo9I GATC 1 cut(s) 123
LmnI GCTCC 1 cut(s) 117
LpnPI CCDG 3 cut(s) 54, 127, 154
LweI GCATC 1 cut(s) 162
MaeI CTAG 1 cut(s) 156
MalI GATC 1 cut(s) 125
MboI GATC 1 cut(s) 123
MboII GAAGA 3 cut(s) 42, 45, 48
MmeI TCCRAC 1 cut(s) 95
MnlI CCTC 6 cut(s) 21, 65, 71, 77, 96, 153
MseI TTAA 1 cut(s) 205
MslI CAYNNNNRTG 1 cut(s) 192
MspR9I CCNGG 1 cut(s) 142
MvaI CCWGG 1 cut(s) 142
MwoI GCNNNNNNNGC 1 cut(s) 28
NdeII GATC 1 cut(s) 123
NlaIII CATG 1 cut(s) 124
Psp6I CCWGG 1 cut(s) 140
PspGI CCWGG 1 cut(s) 140
PspPI GGNCC 1 cut(s) 138
RseI CAYNNNNRTG 1 cut(s) 192
SaqAI TTAA 1 cut(s) 205
Sau3AI GATC 1 cut(s) 123
Sau96I GGNCC 1 cut(s) 138
ScrFI CCNGG 1 cut(s) 142
SetI ASST 6 cut(s) 76, 82, 88, 140, 146, 164
SfaNI GCATC 1 cut(s) 162
SgeI CNNG 8 cut(s) 35, 72, 81, 119, 133, 153, 154, 168
SinI GGWCC 1 cut(s) 138
SmiMI CAYNNNNRTG 1 cut(s) 192
SspMI CTAG 1 cut(s) 156
StyD4I CCNGG 1 cut(s) 140
Tru1I TTAA 1 cut(s) 205
Tru9I TTAA 1 cut(s) 205
TscAI CASTG 1 cut(s) 105
TspDTI ATGAA 1 cut(s) 54
TspRI CASTG 1 cut(s) 105
VpaK11BI GGWCC 1 cut(s) 138
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.