AT3G24065

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0017508
Physical Location & Seq
Reverse (-)
8690574 .. 8691155
582 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G24065.1

Sequence Viewer

Length: 408 bp
ATGATATCCACCAAAGCATATAGCCTCTTCCTTGTCTCCTTAGCCTTAGCCTTTACTTCTTCGTTATCTTTCACGGCTCCAGTCTTCACCGTAAAGGTAACCAACAACCTTGCACTTGACTCTCATCCGTTCACCATAAGATGCACCTCGTCCAAATTAGATACTTCGTCTCAGGTGTTATTTCGAGGTGAGACTTACGTGCTTATGTTTGACACCGACCAATCAACTAGATGGAATTGCGTCATCTTCTCATCATCGGCCAAAATGACTCCTTTCGTCCTCTTTGATCTCGATAGAGACAAATCAAGATGCAAACCCGATGGTTCTTGTCTATGGCAAATCAATCCTGATGGTTTCTACCTATACGTCGCTTCTATTCATAAATACCAAAAGCAATATAAATGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

135

Amino Acids

15.43

Weight (kDa)

8.93

Isoelectric Point (pI)

42.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 30 - 135 1.4e-17 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017508)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G24065 AT3G24068
prunus_persica Prupe.1G060200_v2.0.a1
pyrus_communis pycom16g19650
rosa_chinensis RchiOBHm_Chr4g0396871
rosa_laevigata RLG00000009498
rosa_rugosa Rorug03G0346800
rosa_samantha Rh4AG074200 Rh4BG070900 Rh4CG079000 Rh4DG068200
rosa_wichuraiana Rw4G005970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 258
Alw26I GTCTC 4 cut(s) 40, 174, 185, 291
AoxI GGCC 1 cut(s) 258
AsuHPI GGTGA 3 cut(s) 79, 124, 200
BbsI GAAGAC 1 cut(s) 76
BccI CCATC 3 cut(s) 225, 314, 344
BceAI ACGGC 1 cut(s) 90
BcoDI GTCTC 4 cut(s) 40, 174, 185, 291
BfaI CTAG 1 cut(s) 228
BmiI GGNNCC 1 cut(s) 78
BmsI GCATC 2 cut(s) 131, 299
BpiI GAAGAC 1 cut(s) 76
BpmI CTGGAG 1 cut(s) 63
Bpu10I CCTNAGC 2 cut(s) 40, 46
BsaAI YACGTR 1 cut(s) 199
Bse1I ACTGG 1 cut(s) 80
BseGI GGATG 1 cut(s) 124
BseMII CTCAG 1 cut(s) 185
BseNI ACTGG 1 cut(s) 80
BshFI GGCC 1 cut(s) 260
BsmAI GTCTC 4 cut(s) 40, 174, 185, 291
BsmBI CGTCTC 1 cut(s) 174
BsnI GGCC 1 cut(s) 260
Bsp143I GATC 1 cut(s) 286
BspANI GGCC 1 cut(s) 260
BspCNI CTCAG 1 cut(s) 184
BspLI GGNNCC 1 cut(s) 78
BsrI ACTGG 1 cut(s) 80
BssMI GATC 1 cut(s) 286
Bst4CI ACNGT 1 cut(s) 91
Bst6I CTCTTC 1 cut(s) 32
BstBAI YACGTR 1 cut(s) 199
BstDEI CTNAG 3 cut(s) 40, 46, 171
BstEII GGTNACC 1 cut(s) 97
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 1 cut(s) 289
BstMAI GTCTC 4 cut(s) 40, 174, 185, 291
BstMBI GATC 1 cut(s) 286
BstPI GGTNACC 1 cut(s) 97
BstV2I GAAGAC 1 cut(s) 76
BsuRI GGCC 1 cut(s) 260
BtsCI GGATG 1 cut(s) 124
CseI GACGC 1 cut(s) 229
CviJI RGCY 5 cut(s) 24, 44, 50, 77, 260
CviKI_1 RGCY 5 cut(s) 24, 44, 50, 77, 260
DdeI CTNAG 3 cut(s) 40, 46, 171
DpnI GATC 1 cut(s) 288
DpnII GATC 1 cut(s) 286
EaeI YGGCCR 1 cut(s) 258
Eam1104I CTCTTC 1 cut(s) 32
EarI CTCTTC 1 cut(s) 32
Eco32I GATATC 1 cut(s) 6
Eco91I GGTNACC 1 cut(s) 97
EcoO65I GGTNACC 1 cut(s) 97
EcoRV GATATC 1 cut(s) 6
Esp3I CGTCTC 1 cut(s) 174
FaiI YATR 8 cut(s) 19, 21, 137, 206, 334, 364, 381, 399
FokI GGATG 1 cut(s) 111
FspBI CTAG 1 cut(s) 228
GsuI CTGGAG 1 cut(s) 63
HaeIII GGCC 1 cut(s) 260
HgaI GACGC 1 cut(s) 229
HinfI GANTC 2 cut(s) 119, 268
HphI GGTGA 3 cut(s) 79, 124, 200
Hpy166II GTNNAC 1 cut(s) 132
Hpy188III TCNNGA 3 cut(s) 290, 306, 347
Hpy8I GTNNAC 1 cut(s) 132
Hpy99I CGWCG 1 cut(s) 371
HpyCH4III ACNGT 1 cut(s) 91
HpyCH4IV ACGT 2 cut(s) 198, 366
HpyCH4V TGCA 3 cut(s) 113, 144, 312
HpyF3I CTNAG 3 cut(s) 40, 46, 171
HpySE526I ACGT 2 cut(s) 198, 366
Kzo9I GATC 1 cut(s) 286
LmnI GCTCC 1 cut(s) 82
LpnPI CCDG 3 cut(s) 93, 158, 360
LweI GCATC 2 cut(s) 131, 299
MaeI CTAG 1 cut(s) 228
MaeII ACGT 2 cut(s) 198, 366
MaeIII GTNAC 1 cut(s) 97
MalI GATC 1 cut(s) 288
MboI GATC 1 cut(s) 286
MboII GAAGA 4 cut(s) 19, 51, 76, 238
MluCI AATT 2 cut(s) 155, 235
MlyI GAGTC 2 cut(s) 113, 262
MnlI CCTC 4 cut(s) 35, 157, 179, 290
NdeII GATC 1 cut(s) 286
NlaIV GGNNCC 1 cut(s) 78
PleI GAGTC 2 cut(s) 113, 262
PpsI GAGTC 2 cut(s) 113, 262
Ppu21I YACGTR 1 cut(s) 199
PspEI GGTNACC 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 78
Sau3AI GATC 1 cut(s) 286
SchI GAGTC 2 cut(s) 113, 262
SetI ASST 8 cut(s) 99, 111, 149, 177, 190, 201, 363, 369
SfaNI GCATC 2 cut(s) 131, 299
Sse9I AATT 2 cut(s) 155, 235
SspMI CTAG 1 cut(s) 228
TaaI ACNGT 1 cut(s) 91
TaiI ACGT 2 cut(s) 201, 369
TaqI TCGA 2 cut(s) 184, 291
TasI AATT 2 cut(s) 155, 235
TspDTI ATGAA 1 cut(s) 368
TspGWI ACGGA 1 cut(s) 117
XspI CTAG 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.